SS220 - Вклад [ru]

Разумная болезнь

2026-03-04T11:06:43Z

Krytoi: Переведена почти вся страница кроме таблицы симптомов

{{Требуется перевод}}
{{JobPageHeader
|color = Green
|stafftype = VIRAL
|img_generic =
|img = Icons8 flat biohazard.svg.png
|jobtitle = Разумная болезнь
|access = None
|additional = Wherever your hosts carry you
|difficulty = Сложно
|superior = Ваше ДНК
|duties = Заражать экипаж станции
|guides = Это и есть руководство
|quote = SHUT . . . <big> DOWN </big> . . . <big><big> EVERYTHING </big></big>
}}

Вы разумный вирус с невероятной адаптацией и сопротивлением мутации, который неведомым образом попал на эту космическую станцию Nanotrasen

==Становление разумной болезнью==
[[Random_events#Sentient_Disease|Есть небольшой шанс на случайный ивент который создаст разумную болезнь на станции.]] Разумная болезнь начинает с заражения одного носителя, или же "нулевого пациента", и должна быстро заразить как можно больше людей. Затем болезнь должна дожить до конца смены (с СМО и вирусологом которые будут занозой в вашей заднице) и "добраться" до ЦК. Нету никакого оповещения об появлении разумной болезни, по этому первые заражения должны быть лёгкими. (особенно учитывая то что вы не мутируете сами по себе)

==Задачи==
Все разумные болезни имеют две постоянные задачи:

* Выжить и заразить как можно больше людей.
* Убедиться в том что хотя бы один носитель вируса сбежит на шаттле или капсуле.

[[File:Diseasegreentext.png]]

==Plague Inc.==
[[File:Sentientvirusmenu.png|right|600px]]
[[File:Hudsprites.png|right]]
Разумная болезнь начинает с 0-ём очков эволюции, и получает их за заражение людей. Бóльшая часть [[Infections#Symptoms Table|симптомов описаных здесь]] могут эволюционировать, но не все из них. (представьте лицо СМО перед вирусом с гнилью мозга) Разница разумной болезни и искусственно созданной в том, что разумная может иметь больше чем 6 симптомов. 
 Разумная болезнь имеет две уникальных способностей:
* [[File:Cough.png]] '''Кашель:''' Эта способность заставляет носителя кашлять, распространяя вирус в радиусе двух тайлов. Бесплатен, и единственный симптом который симптом который вы получаете со старта. Ваш основной способ передачи болезни в первые минуты вашего существования. Имеет перезарядку в 10 секунд перед следующим использованием.
* [[File:Sneeze.png]] '''Чихание:''' Эта способность заставляет носителя чихать, распространяя вирус в четыре тайла в форме конуса перед носителем. Стоит 3 очка эволюции, и довольно легко получается. 20 секунд перезарядка между использованиями.

===Развиваемые симптомы (ПРЕДУПРЕЖДЕНИЕ: Эта таблица устарела; Просто читайте внутриигровые описания в вашем меню пока вы ждёте свою перезарядку мутаций)===
{| class="wikitable" border="1" cellspacing="0" cellpadding="2"
! style='background-color:{{ColorPalette|Green|Primary}};' width='193px'|Symptom
! style='background-color:{{ColorPalette|Green|Primary}};' width='80px'|Cost
! style='background-color:{{ColorPalette|Green|Primary}};' width='760px'|Description
|-
!Voluntary Coughing
|0
|Force the host you are following to cough with extra force, spreading your infection to those within two meters of your host even if your transmitability is low. Cooldown: 10 seconds
|-
!Voluntary Sneezing
|3
|Force the host you are following to sneeze with extra force, spreading your infection to any victims in a 4 meter cone in front of your host. Cooldown: 20 seconds
|-
!Involuntary Coughing
|4
|Cause victims to cough intermittently.
|-
!Involuntary Sneezing
|4
|Cause victims to sneeze intermittently, spreading your infection and also increasing transmitability and resistance, at the cost of stealth.
|-
!Beard Growth
|8
|Cause all victims to grow a luscious beard. Decreases stats slightly. Ineffective against Santa Claus.
|-
!Hallucinations
|8
|Cause victims to hallucinate. Decreases stats, especially resistance.
|-
!Choking
|8
|Cause victims to choke, threatening asphyxiation. Decreases stats, especially transmittability.
|-
!Confusion
|8
|Cause victims to become confused intermittently.
|-
!Eternal Youth
|8
|Cause victims to become eternally young. Provides boosts to all stats except transmittability.
|-
!Vomiting
|8
|Cause victims to vomit. Slightly increases transmittability. Vomiting also also causes the victims to lose nutrition and removes some toxin damage.
|-
!Voice Changing
|8
|Change the voice of victims, causing confusion in communications.
|-
!Vision Loss
|8
|Damage the eyes of victims, eventually causing blindness. Decreases all stats.
|-
!Self-Adaptation
|8
|Cause your infection to mimic the function of normal body cells, becoming much harder to spot and to eradicate, but reducing its speed.
|-
!Skin Paleness
|8
|Cause victims to become pale. Decreases all stats.
|-
!Sensory Restoration
|8
|Regenerate eye and ear damage of victims.
|-
!Itching
|8
|Cause victims to itch, increasing all stats except stealth.
|-
!Weight Loss
|8
|Cause victims to lose weight, and make it almost impossible for them to gain nutrition from food. Reduced nutrition allows your infection to spread more easily from hosts, especially by sneezing.
|-
!Itching
|8
|Cause victims to itch, increasing all stats except stealth.
|-
!Metabolic Boost
|16
|Increase the metabolism of victims, causing them to process chemicals twice as fast and grow hungry more quickly.
|-
!Regenerative Coma
|16
|Cause victims to fall into a healing coma when hurt.
|-
|}

====Статистика====
Каждый симптом влияет на 4 характеристики; скрытность, передача, сопротивление и скорость развития, которые всячески могут менять вашу болезнь. Для бóльшей информации смотрите [[Infections#Understanding stats]]. Таблицу с влиянием разных симптомов на характеристики вы можете найти в [[Infections#Symptoms Table|таблице симптомов ниже.]]

==О чёрт у нас разумная болезнь==
* Шаг 1: Используйте маски и включите баллоны
* Шаг 2: Убедитесь что вирусолог/СМО живы
* Шаг 3: Ждите пока они сделают вакцину

Важно подметить что вирус может быть полезным, но что бы распространяться нужно иметь вредные симптомы что бы вы смогли эволюционировать Regenerative Coma или Sensory Restoration/что пожелаете. [[Guide_to_chemistry#Spaceallin|Спейсацилин]] может быть полезен даже если вы уже заражены.

{{Jobs}}
[[Category:Jobs]]
[[Category:Guides]]

Autolathe

2026-03-03T10:20:45Z

Krytoi: Переведено начало

{{Требуется перевод}}
==[[File:autolathe.png|64px]] Автолат==
Не путать с [[Протолатом]]. Автолат - это фабрикатор простых, но всё еще необходимых базовых инструментов и материалов. Должен быть заполнен [[металлом]] или [[стеклом]] перед созданием предметов, и может разбирать предметы на стекло или металл если нужно. Что бы закинуть предмет в автолат кликните им по автолату.

Автолат обычно можно найти в [[офисе карго]], или на некоторых картах в [[лаборатории РнД]].

[[Hacking#Autolathe|Может быть взломан для создания новых предметов, ну или же для поломки]]

[[Guide_to_advanced_construction#Autolathe|Если хотите вы можете создать свой автолат]]

==Список доступных предметов==
Заметка: Все предметы ниже можно создать без улучшенного автолата.

===Construction===
{| class="wikitable sortable mw-collapsible"
|+Electrical Assemblies
!Item
!Cost
!Note
|-
|Condenser
|0.40 Iron, 0.48 Glass
|
|-
|[[Health Sensor]]
|1.28 Iron, 0.32 Glass
|
|-
|Holodisk
|0.16 Iron, 0.16 Glass
|
|-
|[[Igniter]]
|0.8 Iron, 0.08 Glass
|
|-
|[[Infrared Emitter]]
|0.8 Iron, 0.8 Glass
|
|-
|[[Proximity Sensor]]
|1.28 Iron, 0.32 Glass
|
|-
|[[Remote Signaling Device]]
|0.64 Iron, 0.19 Glass
|
|-
|[[Timer]]
|0.8 Iron, 0.08 Glass
|
|-
|[[Voice Analyzer]]
|0.8 Iron, 0.08 Glass
|
|}
{| class="wikitable sortable mw-collapsible"
|+Electronics
!Item
!Cost
!Note
|-
|[[Guide to construction#APC|APC Module]]
|0.16 Iron, 0.16 Glass
|
|-
|[[Air Alarm Electronics]]
|0.08 Iron, 0.08 Glass
|
|-
|[[Airlock Electronics]]
|0.08 Iron, 0.08 Glass
|
|-
|[[Blast Door Controller]]
|0.16 Iron, 0.08 Glass
|
|-
|[[Fire Alarm Electronics]]
|0.08 Iron, 0.08 Glass
|
|-
|[[Guide to construction#Firelock|Firelock Circuitry]]
|0.08 Iron, 0.08 Glass
|
|-
|Ignition Switch Controller
|0.16 Iron, 0.08 Glass
|
|-
|[[Guide to construction#Solar Panels and Trackers|Solar Tracking Electronics]]
|0.16 Iron, 0.8 Glass
|
|-
|Trapdoor Controller Electronics
|0.8 Iron, 0.8 Glass
|Used for Trapdoors, which are only usable on multi-Z stations.
|}

{| class="wikitable sortable mw-collapsible"
|+Frames & Mounts
!Item
!Costs
!Note
|-
|[[Camera Assembly]]
|0.64 Iron, 0.4 Glass
|
|-
|Digital Clock Frame
|11.2 Iron, 6.4 Glass
|
|-
|[[Intercom|Intercom Frame]]
|0.12 Iron, 0.04 Glass
|
|-
|Light Switch Frame
|0.12 Iron, 0.04 Glass
|
|-
|Newscaster Frame
|11.2 Iron, 6.4 Glass
|
|-
|Requests Console Frame
|11.2 Iron, 6.4 Glass
|
|-
|[[Guide to construction#Solar Panels and Trackers|Solar Panel Frame]]
|2.8 Iron, 0.8 Glass
|
|-
|Sparker Wall Frame
|0.8 Iron, 0.8 Glass
|
|-
|Status Display Frame
|11.2 Iron, 6.4 Glass
|
|-
|Ticket Machine Frame
|11.2 Iron, 6.4 Glass
|
|-
|Turret Control Frame
|9.6 Iron
|
|}
{| class="wikitable sortable mw-collapsible"
|+Lighting
!Item
!Costs
!Note
|-
|[[Light fixture|Light Bulb]]
|0.16 Glass
|
|-
|[[Light fixture|Light Fixture Battery]]
|0.03 Glass
|Pre-charged, holds 120 kJ
|-
|[[Light fixture|Light Tube]]
|0.16 Glass
|
|}
{| class="wikitable sortable mw-collapsible"
|+Machinery
!Item
!Costs
!Note
|-
|Conveyor Belt
|1.5 Iron
|
|-
|Conveyor Belt Switch
|0.72 Iron, 0.32 Glass
|
|}
{| class="wikitable sortable mw-collapsible"
|+Materials & Alloys
!Item
!Costs
!Note
|-
|[[Guide to construction#Bananium|Bananium]]
|1 Bananium
|Cost not affected by parts
|-
|Blue Circuit Tile
|0.5 Iron, 0.5 Glass
|
|-
|[[Guide to construction#Diamond|Diamond]]
|1 Diamond
| rowspan="3" |Cost not affected by parts
|-
|[[Glass]]
|1 Glass
|-
|[[Guide to construction#Gold|Gold]]
|1 Gold
|-
|Green Circuit Tile
|0.5 Iron, 0.5 Glass
|
|-
|[[Metal|Iron]]
|1 Iron
| rowspan="4" |Cost not affected by parts
|-
|[[Rods|Iron Rod]]
|0.5 Iron
|-
|[[Guide to construction#Plasma|Plasma]]
|1 Plasma
|-
|[[Guide to construction#Plastic|Plastic]]
|1 Plastic
|-
|Red Circuit Tile
|0.5 Iron, 0.5 Glass
|
|-
|[[Reinforced Glass]]
|0.5 Iron, 1 Glass
| rowspan="4" |Cost not affected by parts
|-
|[[Guide to construction#Silver|Silver]]
|1 Silver
|-
|[[Guide to construction#Titanium|Titanium]]
|1 Titanium
|-
|[[Guide to construction#Uranium|Uranium]]
|1 Uranium
|}

===Equipment===
{| class="wikitable sortable mw-collapsible"
|+Bar & Kitchen Equipment
!Item
!Costs
!Note
|-
|Bowl
|0.8 Iron
|
|-
|Cafeteria Tray
|2.4 Iron
|
|-
|Drinking Glass
|0.8 Glass
|Holds 50 units of liquids, can be broken
|-
|Fork
|0.16 Iron
|
|-
|Kitchen Knife
|9.60 Iron
|
|-
|[[Guide to food#Oven|Oven]] Tray
|0.8 Iron
|
|-
|Plastic Fork
|0.16 Plastic
|
|-
|Plastic Knife
|0.16 Plastic
|
|-
|Plastic Spoon
|0.19 Plastic
|
|-
|Plate
|2.4 Iron
|
|-
|Serving Tray
|2.4 Iron
|
|-
|Shaker
|1.2 Iron
|Holds 100 units of liquid
|-
|Shot Glass
|0.16 Glass
|Holds 15 units of liquid, always transfers all of it's contents, can be broken
|-
|Spoon
|0.19 Iron
|
|-
|Tongs
|0.31 Iron
|
|}
{| class="wikitable sortable mw-collapsible"
|+Chemistry Equipment
!Item
!Costs
!Note
|-
|[[Beaker]]
|0.8 Glass
|Holds 50 units of liquid
|-
|[[Dropper]]
|0.02 Glass, 0.05 Plastic
|Holds 5 units of liquid
|-
|[[Large Beaker]]
|2 Glass
|Holds 100 units of liquid
|-
|[[Medical items#Pill Bottle|Pill Bottle]]
|0.03 Plastic, 0.16 Glass
|
|-
|[[Syringe]]
|0.02 Iron, 0.03 Glass
|Holds 15 units of liquid
|}
{| class="wikitable sortable mw-collapsible"
|+Communications Equipment
!Item
!Costs
!Note
|-
|[[Radio Headset]]
|0.12 Iron
|
|-
|[[Station Bounced Radio]]
|0.12 Iron, 0.04 Glass
|
|}
{| class="wikitable sortable mw-collapsible"
|+Engineering Equipment
!Item
!Costs
!Note
|-
|[[Earmuffs]]
|0.8 Iron, 0.8 Glass
|
|-
|[[Welding Helmet]]
|1.4 Iron, 0.64Glass
|
|}
{| class="wikitable sortable mw-collapsible"
|+Gas Tank Equipment
!
!
!
|-
|Gas Filter
|0.16 Iron
| rowspan="2" |Used with [[Gas masks|Gas Masks]]
|-
|Plasmaman Gas Filter
|0.16 Iron
|}
{| class="wikitable sortable mw-collapsible"
|+Gas Tanks
!Item
!Costs
!Note
|-
|[[Emergency Oxygen Tank]]
|0.8 Iron
|
|-
|Extended-Capacity Emergency Oxygen Tank
|1200 Iron
|'''Contraband''' - Needs the autolathe to be [[Hacking#Autolathe|hacked]]
|-
|Generic Gas Tank
|0.8 Iron
|
|-
|Plasmaman Belt Tank
|1.28 Iron
|'''Contraband''' - Needs the autolathe to be [[Hacking#Autolathe|hacked]]
|}
{| class="wikitable sortable mw-collapsible"
|+Medical Equipment
!Item
!Costs
!Note
|-
|[[Stethoscope]]
|0.8 Iron
|
|}
{| class="wikitable sortable mw-collapsible"
|+Science Equipment
!Item
!Costs
!Note
|-
|Technology Data Storage Disk
|0.48 Iron, 0.16 Glass
|Completely useless in it's current state.
|}
{| class="wikitable sortable mw-collapsible"
|+Security Equipment
!Item
!Costs
!Note
|-
|[[Electropack]]
|8 Iron, 2 Glass
|Appears twice when the autolathe is [[Hacking#Autolathe|hacked]].
|-
|Security Pen
|0.15 Iron
|Writes in red ink, can be pointed at others on a cooldown.
|-
|[[Handcuffs]]
|0.8 Iron
|'''Contraband''' - Needs the autolathe to be [[Hacking#Autolathe|hacked]]
|-
|[[Universal Recorder]]
|0.10 Iron, 0.05 Glass
|Does not start with a tape inserted
|-
|[[Universal Recorder|Universal Recorder Tape]]
|0.03 Iron, 0.03 Glass
|Can hold up to ten minutes of audio
|}
{| class="wikitable sortable mw-collapsible"
|+Service Equipment
!Item
!Costs
!Note
|-
|Box of Cap Gun Shots
|0.03 Iron, 0.02 Glass
|Can be recycled when empty, appears twice when the autolathe is [[Hacking#Autolathe|hacked]].
|-
|Butcher's Cleaver
|14.4 Iron
|'''Contraband''' - Needs the autolathe to be [[Hacking#Autolathe|hacked]]
|-
|Cap Gun
|0.16 Iron, 0.08 Glass
|Appears twice when the autolathe is [[Hacking#Autolathe|hacked]].
|-
|Package Wrapping
|0.20 Iron, 0.20 Glass
|
|-
|Pet Carrier
|6 Iron, 0.16 Glass
|
|-
|Plastic Armblade
|1.6 Plastic
|Appears twice when the autolathe is [[Hacking#Autolathe|hacked]].
|-
|Plastic Balloon
|0.96 Plastic
|Appears twice when the autolathe is [[Hacking#Autolathe|hacked]].
|-
|Plastic Bead Necklace
|0.8 Plastic
|
|-
|Plastic Box
|0.8 Plastic
|
|-
|Plastic Can Rings
|0.96 Plastic
|
|-
|Plastic Potted Plant
|6.40 Plastic
|
|-
|Stasis Fish Case
|0.15 Iron, 0.15 Plastic
|
|-
|[[Sticky tape|Sticky Tape]]
|0.5 Plastic
|
|-
|Toner Cartridge
|0.02 Iron, 0.02 Glass
|
|-
|Toner Cartridge (Large)
|0.08 Iron, 0.08 Glass
|
|}
{| class="wikitable sortable mw-collapsible"
|+Top-Secret Equipment
!Item
!Costs
!Note
|-
|Tinfoil Hat
|4 Iron
|'''Contraband''' - Needs the autolathe to be [[Hacking#Autolathe|hacked]]
|}
{| class="wikitable sortable mw-collapsible"
|+[[Guide to xenobiology|Xenobiology]] Equipment
!Item
!Costs
!Note
|-
|Petri Dish
|0.8 Glass
|
|-
|Slime Scanner
|0.48 Iron, 0.32 Glass
|Effectively useless because of Slime Management Consoles
|-
|Sterile Swab
|0.32 Plastic
|
|}

===Modular Computers===
{| class="wikitable mw-collapsible"
|+Frames
!Item
!Costs
!Note
|-
|Laptop Frame
|8 Iron, 0.8 Glass
|
|}

===Stock Parts===
{| class="wikitable mw-collapsible"
|+Miscellaneous Parts
!Item
!Costs
!Note
|-
|Custom Vendor Refill
|4 Iron, 1.6 Glass
|Needed to make a custom vendor
|}
{| class="wikitable sortable mw-collapsible"
|+Tier 1 [[Guide to Research and Development#Upgrading Machines|Parts]]
!Item
!Costs
!Note
|-
|Basic Capacitor
|0.16 Iron, 0.16 Glass
|
|-
|Basic Matter Bin
|0.16 Iron
|
|-
|Basic Micro-Laser
|0.16 Iron, 0.08 Glass
|
|-
|Basic Power Cell
|1.12 Iron, 0.08 Glass
|Holds 1000 kJ, starts empty
|-
|Basic Scanning Module
|0.16 Iron, 0.08 Glass
|
|-
|Micro Manipulator
|0.16 Iron
|
|}

===Tools===
{| class="wikitable sortable mw-collapsible"
|+Atmospherics Tools
!Item
!Costs
!Note
|-
|Fire Extinguisher
|0.8 Iron
|Empty when printed
|-
|Gas Analyzer
|0.05 Iron, 0.03 Glass
|
|-
|Pocket Fire Extinguisher
|0.08 Iron, 0.06 Glass
|Empty when printed
|}
{| class="wikitable sortable mw-collapsible"
|+Botany Tools
!Item
!Costs
!Note
|-
|Cultivator
|0.08 Iron
|
|-
|Hatchet
|12 Iron
|
|-
|Plant Analyzer
|0.05 Iron, 0.03 Glass
|
|-
|Secateurs
|3.2 Iron
|
|-
|Shovel
|0.08 Iron
|
|-
|Spade
|0.08 Iron
|
|-
|Watering Can
|0.32 Iron
|Empty when printed
|}
{| class="wikitable sortable mw-collapsible"
|+Cargo Tools
!Item
!Costs
!Note
|-
|Boxcutter
|3.2 Iron, 0.8 Plastic
|
|-
|Destination Tagger
|0.4 Iron, 0.24 Glass
|
|-
|Universal Scanner
|1.2 Iron, 0.8 Glass
|
|}
{| class="wikitable sortable mw-collapsible"
|+Engineering Tools
!Item
!Costs
!Note
|-
|[[Airlock painter|Airlock Painter]]
|0.08 Iron, 0.08 Glass
|Starts filled with ink
|-
|[[Cable Coil]]
|0.01 Iron, 0.01 Glass
|Prints one cable coil, unlike techfabs which print entire stacks per individual print.
|-
|Decal Painter
|0.08 Iron, 0.08 Glass
|Starts filled with ink
|-
|[[Emergency welding tool|Emergency Welding Tool]]
|0.05 Iron, 0.02 Glass
|Starts empty
|-
|[[Geiger Counter]]
|0.24 Iron, 0.24 Glass
|
|-
|[[Industrial Welding Tool]]
|0.11 Iron, 0.1 Glass
|'''Contraband''' - Needs the autolathe to be [[Hacking#Autolathe|hacked]], starts empty
|-
|[[Multitool]]
|0.08 Iron, 0.03 Glass
|
|-
|Pipe Painter
|4 Iron, 1.6 Glass
|
|-
|[[Crowbar|Pocket Crowbar]]
|0.08 Iron
|
|-
|Rapid Wiring Device
|8 Iron, 4 Glass
|
|-
|[[Screwdriver]]
|0.12 Iron
|
|-
|[[T-Ray Scanner]]
|0.16 Iron 0.08 Glass
|
|-
|Tile Sprayer
|0.08 Iron, 0.08 Glass
|Starts filled with ink
|-
|[[Toolbox]]
|0.8 of Anything
|Some materials have different effects:

*Iron - Nothing
*Glass - Less integrity
*Plasma - Adds firestacks on hitting someone, and explodes if heated or combusted.
*Uranium - Radioactive
*Gold - More force
*Titanium - More force
*Biomass - Less force
*Bluespace crystals - Nothing yet
*Diamond - Nothing yet
*Plastic - Less force
*Bananium - Honks and slips
*Runite - Gains a random RPG trait. Ones that have any form of "hungering" in their names are His Grace-but-bad! (Thank you Livrah for showing this to me)
|-
|[[Welding Tool]]
|0.11 Iron, 0.03 Glass
|Starts empty
|-
|[[Wirecutters]]
|0.13 Iron
|
|-
|[[Wrench]]
|0.24 Iron
|
|}
{| class="wikitable sortable mw-collapsible"
|+Janitorial Tools
!Item
!Costs
!Note
|-
|[[Bucket]]
|0.32 Iron
|Holds 70 units of liquid, has a random color
|-
|[[Mop]]
|0.8 Iron
|
|-
|Push Broom
|1.6 Iron
|
|-
|Wirebrush
|0.32 Iron, 0.32 Glass
|
|}
{| class="wikitable sortable mw-collapsible"
|+Medical Tools
!Item
!Costs
!Note
|-
|[[Medical items#Blood Filter|Blood Filter]]
|3.2 Iron, 1.2 Glass, 0.8 Silver
|
|-
|[[Medical items#Bonesetter|Bonesetter]]
|4 Iron, 2 Glass
|
|-
|[[Medical items#Cautery|Cautery]]
|2 Iron, 1.2 Glass
|
|-
|[[Medical items#Circular Saw|Circular Saw]]
|8 Iron, 4.8 Glass
|
|-
|[[Medical items#Hemostat|Hemostat]]
|4 Iron, 2 Glass
|
|-
|[[Medical items#Retractor|Retractor]]
|4.8 Iron, 2.4 Glass
|
|-
|[[Medical items#Scalpel|Scalpel]]
|3.2 Iron, 0.8 Glass
|
|-
|[[Medical items#Surgical Drill|Surgical Drill]]
|8 Iron, 4.8 Glass
|
|}
{| class="wikitable sortable mw-collapsible"
|+Mining Tools
!Item
!Costs
!Note
|-
|[[Pickaxe]]
|1.6 Iron
|
|}
{| class="wikitable sortable mw-collapsible"
|+Miscellaneous Tools
!Item
!Costs
!Note
|-
|[[Flashlight]]
|0.08 Iron, 0.03 Glass
|
|}
{| class="wikitable sortable mw-collapsible"
|+Plumbing Tools
!Item
!Costs
!Note
|-
|Fluid Duct
|0.5 Iron
|
|-
|Plunger
|0.24 Iron
|
|}
{| class="wikitable sortable mw-collapsible"
|+Service Tools
!Item
!Costs
!Note
|-
|[[Camera]]
|0.08 Iron, 0.16 Glass
|Starts with 10 photos
|-
|Camera Film Cartridge
|0.02 Iron, 0.02 Glass
|Use on camera
|-
|[[Guide to Sculpting|Chisel]]
|0.12 Iron
|
|-
|Confidential Paper Biscuit
|0.05 Plastic
|'''Contraband''' - Needs the autolathe to be [[Hacking#Autolathe|hacked]], looks like the biscuit for the Spare ID Code
|-
|Electric Razor
|0.12 Iron
|
|-
|Fishing Rod
|0.32 Iron, 0.32 Glass
|
|-
|[[Hand Labeler]]
|0.24 Iron, 0.2 Glass
|Starts filled
|-
|Hand Labeler Paper Roll
|0.08 Iron, 0.04 Iron
|
|-
|Paper Biscuit
|0.03 Plastic
|Can hold a sheet of paper and be closed.
|-
|Spraycan
|0.16 Iron, 0.16 Glass
|
|}

===Weaponry===
{| class="wikitable sortable mw-collapsible"
|+Ammunition
!Item
!Costs
!Note
|-
|.310 Surplus Bullet Casing (VERY Lethal)
|3.2 Iron
|
|-
|.357 Casing (VERY Lethal)
|3.2 Iron
| rowspan="4" |'''Contraband''' - Needs the autolathe to be [[Hacking#Autolathe|hacked]]
|-
|Ammo Box (.45) (Lethal)
|48 Iron
|-
|Ammo Box (10mm) (Lethal)
|48 Iron
|-
|Ammo Box (9mm) (Lethal)
|48 Iron
|-
|Beanbag Slug (Less Lethal)
|1.6 Iron
|
|-
|Box of Foam Darts (Harmless)
|0.8 Iron
|
|-
|Foam Riot Dart (Nonlethal)
|0.8 Iron
| rowspan="3" |'''Contraband''' - Needs the autolathe to be [[Hacking#Autolathe|hacked]]
|-
|Foam Riot Dart Box (Nonlethal)
|40 Iron
|-
|Incendiary Slug (Lethal)
|3.2 Iron
|-
|Rubber Shot (Less Lethal)
|3.2 Iron
|
|-
|Shotgun Dart (Lethal)
|3.2 Iron
|'''Contraband''' - Needs the autolathe to be [[Hacking#Autolathe|hacked]]
|-
|Speed Loader (.38) (Lethal)
|16 Iron
|
|}
{| class="wikitable sortable mw-collapsible"
|+Ranged Weapons
!Item
!Costs
!Note
|-
|Flamethrower
|0.8 Iron
|'''Contraband''' - Needs the autolathe to be [[Hacking#Autolathe|hacked]], starts without a gas tank. More expensive to print than to craft it.
|}
{| class="wikitable sortable mw-collapsible"
|+Weapon Parts
!Item
!Costs
!Note
|-
|Modular Receiver
|12 Iron
|Appears twice when the autolathe is [[Hacking#Autolathe|hacked]].
|}

==Importing Designs, AKA Making an Omnilathe==
Using a design disk on an autolathe will attempt to upload it's designs to the lathe, unlocking it under the "Imported Designs" tab. This is used with the Enshrined Disc of Smithing (found in a ruin) and Magic Disk of Smithing (Found in a lavaland ruin), which unlock a Cleric Mace and Knight Armour/Helmet respectively. Once unlocked, they can be made from any material, most notably [[Guide_to_construction#Runite|Runite]] [[File:Runite_stack.png]].

The fun part about this however, is that provided you have a Component Design Disk and an R&D Console, you can add almost any design a techfab can make to the autolathe. --- '''DISCLAIMER: This has been severely nerfed, as you can no longer print design disks, ever since''' [https://github.com/tgstation/tgstation/pull/74147 '''this PR (#74147)'''] Provided you're lucky enough to get your hands on one of the disks of smithing, you can still very much do this, better, even, since these disks have a whopping FIVE (compared to the previous limit of one) designs on it. Before you ask; No, the BEPIS disks don't work.

*First, insert the Component Design Disk into the R&D Console.
*A '''"Design Disk Inserted"''' Button should appear into the R&D Console, click on it to open the design disk tab.
*Once in the design disk tab, you should see several buttons, but the one that's interesting for now is the '''"Load Design to Slot"''', or '''"Overwrite Slot"''' if it already has a design on it. Click it and select the item you want to add onto the disk. ''Keep in mind that you can only have one design per slot, making this a fairly lengthy process if you really want to make a proper omnilathe.''
*Once you've selected the design you want, hit the '''"Eject"''' button to remove the disk from the console.
*Use the now loaded disk on the autolathe to upload the design: Congratulations, you can now print that item in the lathe!

Now you can:

*Turn Cargo into an unholy combination of every department with a single circuit imprinter board!
*Print a Plumbing Constructor and make a grenade factory as any department member!
*Print higher tier parts without having to <s>tide into</s> ask science or engineering every five minutes!

[[Category:Dispensers]]
[[Category:Objects]]

Химические рецепты

2026-03-03T10:07:54Z

Krytoi: Исправлена нелогичность в предложении

{{Требуется перевод}}
Устали жонглировать бутылками при смешивании сложных химикатов?

Если не указано иначе, предполагается что вы будете использовать 100u ёмкость (Большой бикер/большая бутылка воды/шейкер и т. д.)

= Запись Химических Рецептов =
{{anchor|Chemical Macros}}Вы можете записывать рецепты кликая в раздатчиках химикатов/бухла/напитков кликая "Record Recipe". Затем налейте реагентов которых хотите и кликните "Save". Посмотрите пример на гифке: 
[[File:JJRcops_chem_recording_example.gif]]
= Химические Макросы =
Август 2019, макросы были удалены с /tg/station, и были заменены с записью рецептов. Таблица оставлена для других станций использующих старый /tg/code.

<div class="toccolours mw-collapsible mw-collapsed">
Кликните что бы развернуть таблицу:
<div class="mw-collapsible-content">
You can save recipes in the chem dispenser to instantly dispense a certain combination of chemicals at the touch of a button at the remaining cost of dispenser power.

Recipes are tied to a specific Chem Dispenser, and anyone using that dispenser will be able to see, use and erase recipes in it. You also cannot remove individual recipes, as the dispenser only allows you to add recipes and erase all recipes saved.

You can give your recipe any name, and you enter the ingredients in the format <code><ingredient_id>=<amount></code>, separated by semicolons.
For example:
{|
|----
|<code>oxygen=20;nitrogen=15;carbon=10</code>
|-
|<code>water=100</code>
|-
|<code>sulfur=10;ethanol=50</code>
|----
|}

If your recipe doesn't appear in the chem dispenser menu, then you've most likely entered it incorrectly, so try again.
{| class="wikitable sortable" style="width:35%; text-align:left; border: 3px solid #FFDD66; cellspacing=0; cellpadding=2; background-color:white;"
|+ style="caption-side:bottom|"Dispenser Reagents"
! scope="col" style='width:70px; background-color:#FFDD66;'|Name
! scope="col" class="unsortable" style='background-color:#FFDD66;'|Ingredient ID
|-
|Welding Fuel
|welding_fuel
|-
|Stable Plasma
|stable_plasma
|-
|Carbon Dioxide
|co2
|-
|Oxygen
|oxygen
|-
|Hydrogen
|hydrogen
|-
|Nitrogen
|nitrogen
|-
|Chlorine
|chlorine
|-
|Fluorine
|fluorine
|-
|Mercury
|mercury
|-
|Sulfur
|sulfur
|-
|Sulphuric acid
|sacid
|-
|Silicon
|silicon
|-
|Iodine
|iodine
|-
|Ethanol
|ethanol
|-
|Bromine
|bromine
|-
|Radium
|radium
|-
|Lithium
|lithium
|-
|Phosphorus
|phosphorus
|-
|Sodium
|sodium
|-
|Sugar
|sugar
|-
|Silver
|silver
|-
|Iron
|iron
|-
|Copper
|copper
|-
|Aluminum
|aluminum
|-
|Space Drugs
|space_drugs
|-
|Morphine
|morphine
|-
|Miner's Salve
|mine_salve
|-
|Toxin
|toxin
|-
|Carpotoxin
|carpotoxin
|}
</div>
</div>



== Полезные макросы игроков ==
'''Больше не могут быть использованы на /tg/station.''' 

Кликните [https://docs.google.com/spreadsheets/d/12vRyMwELUs-dlXZN5jtBHTzW2SyXln47KEhT8nDbuzI/edit?usp=sharing this spreadsheet] для большого списка макросов созданных игроками. Упразднено Июля 21 2019. 

'''Old/outdated list below:''' Many of the following macros are outdated and no longer work. Some of them may only work at a later tech level since you need to upgrade the manipulators in the machine to dispense less than 5u (down to 1u minimum).

<div class="toccolours mw-collapsible mw-collapsed">
Click expand to see the list:
<div class="mw-collapsible-content">
* Oil (3u): welding_fuel=1;carbon=1;hydrogen=1
* Phenol(9u): welding_fuel=1;carbon=1;hydrogen=1;water=3;chlorine=3
* Acetone (9u): welding_fuel=4;carbon=1;hydrogen=1;oxygen=3

* Diethylamine (60u): hydrogen=30;nitrogen=10;ethanol=30
* Saltpetre (30u): potassium=10;nitrogen=10;oxygen=30
* Unstable Mutagen (90u): chlorine=30;phosphorus=30;radium=30

* Silver Sulfadiazine (90u): hydrogen=18;nitrogen=6;silver=18;sulfur=18;oxygen=18;chlorine=18
* Styptic Powder (100u): aluminium=25;hydrogen=25;oxygen=25;sacid=25
* Saline Glucose (90u): sodium=10;chlorine=10;water=40;sugar=30
* Tricordrazine(90u): nitrogen=10;silicon=25;potassium=10;carbon=25;oxygen=10;sugar=10
* Cryoxadone (90u): chlorine=10;phosphorus=10;radium=10;welding_fuel=14;carbon=4;hydrogen=4;oxygen=10;stable_plasma=30
* Clonexadone (add 5u of plasma): chlorine=5;phosphorus=5;radium=5;welding_fuel=7;carbon=2;hydrogen=2;oxygen=5;stable_plasma=15;sodium=45
* Mannitol(99u): hydrogen=33;water=33;sugar=33
* Salicylic Acid(45u): welding_fuel=1;carbon=10;hydrogen=1;water=3;chlorine=3;sodium=9;oxygen=9;sacid=9
* Oxandrolone (54u): welding_fuel=1;carbon=28;hydrogen=10;water=3;chlorine=3;oxygen=9
* Perfluorodecalin (heat to 370): hydrogen=4;fluorine=3;welding_fuel=1;carbon=1
* Atropine(45u): sacid=9;welding_fuel=5;carbon=2;hydrogen=8;oxygen=3;water=3;chlorine=3;ethanol=15;nitrogen=2
* Mutadone (90u): chlorine=10;phosphorus=10;radium=10;welding_fuel=14;carbon=4;hydrogen=4;oxygen=10;bromine=30

* Ephedrine(24u): hydrogen=11;nitrogen=1;ethanol=3;sugar=6;welding_fuel=2;carbon=2
* Epinephrine (54u): welding_fuel=5;carbon=2;hydrogen=17;water=3;oxygen=12;chlorine=12;nitrogen=2;ethanol=6
* Diphenhydramine (24u): welding_fuel=2;carbon=8;hydrogen=5;bromine=6;nitrogen=1;ethanol=9
* Synaptizine(30u): sugar=10;lithium=10;water=10
* Spaceacillin(60u): welding_fuel=5;carbon=2;hydrogen=17;water=3;oxygen=22;chlorine=12;nitrogen=2;ethanol=6;potassium=10;sugar=10
* Haloperidol(45u): welding_fuel=3;carbon=3;hydrogen=3;potassium=5;iodine=5;aluminium=9;fluorine=9;chlorine=9
* Pentetic acid(54u): stable_plasma=1;radium=1;phosphorus=1;welding_fuel=4;carbon=4;hydrogen=16;nitrogen=4;oxygen=14;oxygen=12;ethanol=12;silver=12;oxygen=10;oxygen=12;hydrogen=36;nitrogen=12;sodium=36;chlorine=36;welding_fuel=36

* Methamphetamine(Heat to 374): hydrogen=35;nitrogen=1;ethanol=3;sugar=6;welding_fuel=2;carbon=2;iodine=24;phosphorus=24
* Space Drugs (30u): lithium=10;mercury=10;sugar=10

* Napalm(9u): welding_fuel=4;carbon=1;hydrogen=1;ethanol=3

* Space Cleaner (18u): nitrogen=3;hydrogen=9;water=9
* Space Lube (12u): oxygen=3;silicon=3;water=3

* Chloral Hydrate(20u): chlorine=60;ethanol=20;water=20
* Sulfonal(27u): welding_fuel=4;carbon=1;hydrogen=7;oxygen=3;nitrogen=2;ethanol=6;sulfur=9
* Lipolicide (36u): hydrogen=17;nitrogen=3;ethanol=9;sugar=6;welding_fuel=2;carbon=2;mercury=12
* Formaldehyde(9u, heat to 420): ethanol=3;oxygen=3;silver=3
* Fentanyl(30u, heat to 674): lithium=10;mercury=10;sugar=10
* Cyanide (9u): welding_fuel=1;carbon=1;hydrogen=4;nitrogen=1;oxygen=3
* Heparin (60u, heat to 420): ethanol=5;oxygen=5;silver=5;sodium=15;chlorine=15;lithium=15

* Antihol + Inacusiate + Oculine Step 01/02: sodium=5;chlorine=5;water=5;welding_fuel=5;carbon=5;hydrogen=5
* Antihol + Inacusiate + Oculine Step 02/02: carbon=20;ethanol=10;copper=10;water=10;hydrogen=10 //then heat the mix
* Fluorosulfuric Acid (100u): fluorine=25;hydrogen=25;potassium=25;sacid=25 //then heat the mix
</div>
</div>
 

= Manual Recipes for Drinks =
{{anchor|Drinks}}
Here follows a list of simplified step-by-step instructions to mix drinks and change lives. Anyone can edit the wiki page to add additional recipes or update outdated ones.

== [[Guide_to_drinks#Bacchus'_Blessing|Bacchus' Blessing]][[File:Bacchus_blessing.png|64px]] ==

Acquire '''5u''' Universal Enzyme and a bottle of Absinthe. 
Universal Enzyme is found in the kitchen or ordered at Cargo.
*Add '''60u''' Ethanol, '''30u''' Welder Fuel, '''5u''' Universal Enzyme (catalyst)
*Remove Universal Enzyme, set beaker aside
*Add '''25u''' Beer, '''20u''' Ale, '''10u''' Whiskey
*Add '''5u''' Cola
*Remove '''10u'''
*Add '''25u''' Hooch+Absinthe

== [[Guide_to_drinks#Hearty_Punch|Hearty Punch]][[File:Hearty_punch.png|64px]] ==

You'll need a spray bottle to mix this - most maps start with a bunch in the medical area. 

Grab a bottle of Absinthe and Kahlua from the bar fridge
* Add '''60u''' Beer, '''40u''' Whiskey, '''20u''' Cola
* Remove '''45u'''
* Add '''50u''' Tequila, '''25u''' Kahlua
* Add '''75u''' Absinthe
* Heat to >315°K
-> Results in '''15u'''

== [[Guide to food and drinks#Neurotoxin|Neurotoxin]][[File:Neurotoxin.gif|64px]] ==

Neurotoxin is also a very good toxin.

* Add '''10u''' Gin, Vodka, Whiskey, Cognac, Lime Juice
* Add '''50u''' Morphine (found in Nanomed Plus)

== [[Guide to food and drinks#Changeling Sting|Changeling Sting]][[File:ChangelingSting.gif|64px]] ==

* Add '''20u''' Vodka
* Add '''10u''' Orange Juice
* Add '''50u''', then an additional '''10u''' of Lemon-Lime

* You probably want to disguise the drink, lest you get beaten up by security.
* Remove '''40u''', then remove an additional '''5u'''
* Add '''50u''', the an additional '''5u''' of [[Guide to food and drinks#Basic Drink Ingredients|whatever.]] The main point is to disguise the cocktail.

== [[Guide to food and drinks#Bahama Mama|Bahama Mama]][[File:Bahamamamaglass.gif|64px]] ==

* Add '''30u''' Rum, Orange Juice
* Add '''15u''' Lime Juice, Ice

== [[Guide to food and drinks#Cuba Libre|Cuba Libre]][[File:CubaLibre.png|64px]] ==

* Add '''30u''' Space Cola (found in Booze-O-Mat)
* Add '''60u''' Rum

== [[Guide to food and drinks#Demons Blood|Demons Blood]][[File:Demonsbloodglass.gif|64px]] ==

* Add '''25u''' Space Mountain Wind, Dr. Gibb (both found in Robust Softdrinks), Rum, Blood

== [[Guide to food and drinks#Doctor's Delight|Doctor's Delight]][[File:DoctorDelight.gif|64px]] ==

'''Skip this part if you already have 20u Cryoxadone ready'''
* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''15u''' Oxygen, Welding Fuel
* Remove '''15u'''
* Add '''5u''' Chlorine, Phosphorus, Radium
* Add '''15u''' Stable Plasma
* Remove '''25u'''
-> '''20u''' Cryoxadone
* Add '''20u''' Lime Juice, Tomato Juice, Orange Juice, Milk Cream (found in Booze-O-Mat)

== [[Guide to food and drinks#Fetching Fizz|Fetching Fizz]][[File:Fetching_fizz.png|64px]] ==

* Add '''60u''' Space Cola
* Add '''10u''' Uranium (found by grinding uranium ore sheets)
* Remove '''20u'''
* Add '''50u''' Iron

== [[Guide to food and drinks#Three Mile Island Iced Tea|Three Mile Island Iced Tea]][[File:Threemileislandglass.gif|64px]] ==

* Add '''5u''' Space Cola (found in Booze-O-Mat)
* Add '''10u''' Rum
* Add '''15u''' Vodka, Gin, Tequila
* Remove '''10u'''
* Add '''10u''' Uranium (found by grinding uranium ore sheets)

== [[Guide to food and drinks#Telepole|Telepole]][[File:TelepoleGlass.png|alt=|64x64px]] ==

* Add '''35u''' Sol Dry
* Add '''15u''' Rum
* Add '''25u''' Voltaic Yellow Wine (found in Booze-O-Mat)
* Add '''25u''' Sake

== [[Guide to food and drinks#Pod Tesla|Pod Tesla]][[File:PodTeslaGlass.png|alt=|64x64px]] ==

Skip to step 5 if you already have telepole

* Add '''35u''' Sol Dry
* Add '''15u''' Rum
* Add '''25u''' Voltaic Yellow Wine (found in Booze-O-Mat)
* Add '''25u''' Sake
* Get a Second Glass bottle from Booze-O-Mat
* Add '''60u''' Navy Rum
* Add '''20u''' Vermouth
* Add '''20u''' Fernet (found in [[Hacking|hacked]] Booze-O-Mat)
* Get a Third Glass Bottle
* Add '''5u''' Kahlua
* Add '''10u''' Tequila
* Add '''25u''' of telepole from Bottle 1
* Add '''25u''' of admiralty from Bottle 2
* Repeat the last 4 steps until Bottles 1 and 2 are empty

== [[Guide to food and drinks#Atomic Bomb|Atomic Bomb]][[File:Atomicbombglass.gif|64px]] ==

* Add '''20u''' Whiskey
* Add '''10u''' Milk Cream (found in Booze-O-Mat)
* Add '''30u''' Kahlúa, Cognac
* Remove '''30u''', then remove an additional '''10u'''
* Add '''10u''' Uranium (found by grinding uranium ore sheets)

= Manual Recipes for Medicines =
{{anchor|Medicines}}

== [[Cryoxadone]] and [[Mutadone]] ==
* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''15u''' Oxygen, Welding Fuel
* Remove '''15u''' from the beaker
* Add '''10u''' Chlorine, Phosphorus, Radium
* [[Mutadone]]: Add '''30u''' Bromine
* [[Cryoxadone]]: Add '''30u''' Stable Plasma

=== [[Guide to chemistry#Clonexadone|Clonexadone]] ===
* Remove '''40u''', then remove an additional '''5u''' of the [[Guide to chemistry#Cryoxadone|Cryoxadone]]
* Add '''40u''', then an additional '''5u''' of Sodium
* Add '''5u''' of Plasma (Chemistry starts the shift with some plasma on the desk. Grind the plasma up!)

== [[Atropine]] ==
* Add '''10u''' Carbon, Hydrogen, Welding Fuel
* Remove '''10u'''
* Add '''10u''' Chlorine, Water, Welding Fuel, Oxygen
* Add '''15u''' Hydrogen, Ethanol
* Add '''5u''' Nitrogen
* Remove '''30u'''
* Add '''20u''' Ethanol, Sulphuric Acid

== [[Pentetic Acid]] ==
* Add '''5u''' Carbon, Hydrogen, Nitrogen, Welding Fuel
* Add '''15u''' Hydrogen, Oxygen
* Remove '''30u'''
* Heat to 380°K
* Add '''5u''' Ethanol, Oxygen, Silver
* Heat to >420°K
* Add '''5u''' Nitrogen
* Add '''15u''' Chlorine, Hydrogen, Sodium, Welding Fuel

== [[Salbutamol]] ==

* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Remove '''10u'''
* Add '''5u''' Chlorine, Water
* Remove '''5u'''
* Add '''10u''' Carbon, Oxygen, Sulphuric Acid, Sodium
* Remove '''20u'''
* Add '''30u''' Hydrogen
* Add '''10u''' Nitrogen
* Remove '''20u'''
* Add '''20u''' Aluminum, Bromine, Lithium

== [[Epinephrine]] ==

* Add '''15u''' Ethanol+Hydrogen, '''5u''' Nitrogen
* Remove '''15u'''
* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''5u''' Chlorine, Oxygen, Water, Welding Fuel
* Add '''15u''' Chlorine, Hydrogen, Oxygen
* Remove '''5u''' Oil with ChemMaster

== [[Synthflesh]] ==
For 90u, impure Synthflesh (''very'' likely to heal inefficiently):
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Remove '''10u'''
* Add '''5u''' Chlorine, Water
* Remove '''5u'''
* Add '''10u''' Nitrogen, Oxygen
* Add '''30u''' Carbon, Blood (or 5u Blood + 25u Unstable Mutagen)

== [[Guide to chemistry#Anacea|Anacea]] ==

* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Remove '''5u'''
* Add '''5u''' Potassium, Iodine
* Add '''10u''' Chlorine, Fluorine, Aluminum
* Remove '''20u'''
* Add '''15u''' Mercury, Oxygen, Sugar
* Add '''30u''' Radium

== [[Guide to chemistry#Sulfonal|Sulfonal]] ==

* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Remove '''5u'''
* Add '''10u''' Welding Fuel, Oxygen
* Add '''15u''' Hydrogen, Ethanol
* Add '''5u''' Nitrogen
* Add '''30u''' Sulfur

== [[Guide to chemistry#Antihol|Antihol]] + [[Inacusiate]] + [[Oculine]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''20u''' Carbon
* Add '''10u''' Ethanol, Copper, Water, Hydrogen
* Heat to >480°K

== [[Guide to chemistry#Antihol|Antihol]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Add '''15u''' Ethanol, Copper

== [[Guide to chemistry#Inacusiate|Inacusiate]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Add '''15u''' Carbon, Water

== [[Guide to chemistry#Oculine|Oculine]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Add '''15u''' Carbon, Hydrogen

== [[Guide to chemistry#Salicyclic Acid|Salicyclic Acid]] ==

* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Water, Chlorine
* Remove '''20u''', then remove an additional '''5u'''
* Add '''20u''' Sodium, Carbon, Oxygen, Sulphuric Acid

== [[Guide to chemistry#Oxandrolone|Oxandrolone]] ==

* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Water, Chlorine
* Remove '''30u'''
* Add '''45u''' Carbon
* Add '''15u''' Hydrogen, Oxygen

== [[Guide to chemistry#Strange Reagent|Strange Reagent]] ==

* Add '''10u''' Chlorine, Phosphorus, Radium
* Add '''30u''' Holy Water (Ask the chaplain to bless it for you)
* Add '''30u''' Omnizine (Found in heated Donk Pockets, Ambrosia Deus, and in the CMO's hypospray)

== [[Guide to chemistry#Haloperidol|Haloperidol]] ==

* Add '''10u''' Welding Fuel, Carbon, Hydrogen
* Remove '''10u'''
* Add '''10u''' Potassium, Iodine
* Add '''20u''' Chlorine, Fluorine, Aluminum

== [[Guide to chemistry#Rezadone|Rezadone]] ==

* Carpotoxin, an ingredient in Rezadone, can only be found from Space Carp, Koi Beans, or Emagged Chem Dispensers

* Add '''10u''' Oxygen, Potassium, Sugar
* Add '''30u''' [[Guide to chemistry#Carpotoxin|Carpotoxin]]
* Add '''30u''' Copper

== [[Guide to chemistry#Saline-Glucose Solution|Saline-Glucose Solution]] ==

* Add '''10u''' Sodium, Chlorine, Water
* Add '''30u''' Water, Sugar

==[[Guide to chemistry#Multiver|Multiver]] (previously [[Guide to chemistry#Charcoal|Charcoal]])==
* Add '''15u''' Sodium, Chlorine, Water
* Add '''15u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K

== [[Guide to chemistry#Spaceacillin|Spaceacillin]] ==

* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Remove '''20u'''
* Get a separate beaker
* Add '''10u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Welding Fuel, Oxygen, Water, Chlorine
* Remove '''70u'''
* Add '''20u''' of the resulting [[Guide to chemistry#Acetone|Acetone]] and [[Guide to chemistry#Phenol|Phenol]] to the main beaker
* Add '''10u''' Oxygen, Chlorine, Hydrogen
* Remove '''15u'''
* Add '''15u''' Oxygen, Potassium, Sugar

== [[Guide to chemistry#Higadrite|Higadrite]] ==

* Add '''10u''' Welding Fuel, Carbon, Hydrogen
* Remove '''10u'''
* Add '''20u''' Water, Chlorine
* Add '''30u''' Lithium

== [[Guide to chemistry#Leporazine|Leporazine]] ==

* Add '''45u''' Copper, Silicon
* Add '''5u''' Plasma (found in grinded sheets of plasma ore)

== [[Guide to chemistry#Diphenhydramine|Diphenhydramine]] ==

* Add '''30u''' Hydrogen
* Add '''10u''' Nitrogen
* Remove '''10u'''
* Get a separate beaker
* Add '''10u''' Welding Fuel, Carbon, Hydrogen
* Remove '''10u'''
* Add '''20u''' of the resulting [[Guide to chemistry#Oil|Oil]] to the main beaker
* Add '''20u''' Carbon, Bromine, Ethanol

== [[Guide to chemistry#Lenturi|Lenturi]] (Previously [[Guide to chemistry#Ichiyuri|Ichiyuri]]) ==
(Ichiyuri is now a failed chem acquired from failing to make Lenturi.)

* Add '''30u''' Hydrogen
* Add '''10u''' Nitrogen
* Remove '''10u'''
* Add '''20u''' Silver, Sulfur, Oxygen, Chlorine

== [[Guide to chemistry#Ephedrine|Ephedrine]] ==

* Add '''15u''' Hydrogen, Ethanol
* Add '''5u''' Nitrogen
* Add '''10u''' Welding Fuel, Carbon, Hydrogen
* Remove '''10u'''
* Add '''25u''' Sugar, Hydrogen

== [[Guide to chemistry#Sterilizine|Sterilizine]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Add '''30u''' Chlorine, Ethanol

== [[Guide to chemistry#Pyroxadone|Pyroxadone]] ==

* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''15u''' Oxygen, Welding Fuel
* Remove '''15u''' from the beaker
* Add '''10u''' Chlorine, Phosphorus, Radium
* Add '''30u''' Stable Plasma
* Remove '''45u'''
* Add '''45u''' [[Guide to chemistry#Slime Jelly|Slime Jelly]]

== [[Guide to chemistry#Energized Jelly|Energized Jelly]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to 480°K. Adding the following chemicals will cool the mix below the explosion threshold.
* Add '''10u''' Potassium, Nitrogen
* Add '''30u''' Oxygen
* Add '''30u''' Sulfur
* Remove '''50u''', then remove an additional '''20u''' and '''5u'''
* Add '''15u''' Stable Plasma, Silver
* Heat to 400°K
* Add '''45u''' [[Guide to chemistry#Slime Jelly|Slime Jelly]]

= Manual Recipes for Pyrotechnics =
{{anchor|Pyrotechnics}}

== [[Guide to chemistry#Gunpowder|Gunpowder]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to 481°K. Adding the following chemicals will cool the mix below the explosion threshold.
* Add '''10u''' Potassium, Nitrogen
* Add '''30u''' Oxygen
* Add '''30u''' Sulfur

Note: Gunpowder ignites at 474°K.

== [[Guide to chemistry#Nitroglycerin|Nitroglycerin]] ==

* Add '''30u''' Corn Oil (bug botany)
* Add '''10u''' Sulphuric Acid
* Remove '''10u'''
* Get a separate beaker
* Add '''10u''' Fluorine, Hydrogen, Potassium, Sulphuric Acid
* Heat to >380°K
* Remove '''10u'''
* Add '''30u''' of the resulting [[Guide to chemistry#Fluorosulfuric Acid|Fluorosulfuric Acid]] to the main beaker
* Get a separate beaker
* Add '''5u''' Iron, Oxygen, Hydrogen
* Use a dropper to draw '''1u''' of the resulting [[Guide to chemistry#Stabilizing Agent|Stabilizing Agent]] to the main beaker
* Dispose of the separate beaker
* Add '''30u''' Sulphuric Acid

* Heat to >474°K for the solution to explode

== [[Guide to chemistry#Napalm|Napalm]] ==

* Add '''10u''' Welding Fuel, Carbon, Hydrogen
* Add '''30u''' Welding Fuel, Ethanol

== [[Guide to chemistry#Meth Explosion|Meth Explosion]] ==

* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Remove '''5u'''
* Add '''25u''' Iodine Phosphorus
* Cool to about 0°K using the space heater
* Add '''25u''' Hydrogen

* Heat to 300°K (room temperature) to activate an explosion

== [[Guide to chemistry#Teslium|Teslium]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to 480°K. Adding the following chemicals will cool the mix below the explosion threshold.
* Add '''10u''' Potassium, Nitrogen
* Add '''30u''' Oxygen
* Add '''30u''' Sulfur
* Remove '''50u''', then remove an additional '''20u''' and '''5u'''
* Add '''15u''' Stable Plasma, Silver
* Heat to 400°K

* Heat to >474°K to activate an explosion

== [[Guide to chemistry#Chlorine Trifluoride|Chlorine Trifluoride]] ==

* Add '''50u''', then add an additional '''25u''' Fluorine
* Add '''25u''' Chlorine
* Heat to >424°K

== [[Guide to chemistry#Fluorosulfuric Acid|Fluorosulfuric Acid]] ==

* Add '''25u''' Fluorine, Hydrogen, Potassium, Sulphuric Acid
* Heat to >380°K

= Manual Recipes for Drugs =
{{anchor|Drugs}}

== [[Guide to chemistry#Morphine|Morphine]] ==

* Add '''30u''' Carbon, Hydrogen
* Add '''15u''' Ethanol, Oxygen
* Heat to >480K

== [[Guide to chemistry#Methamphetamine|Meth]] ==

* Add 15u Hydrogen
* Add 5u Nitrogen
* Add 15u Ethanol
* Remove 15u
* Add 5u Welding Fuel, Carbon, Hydrogen
* Add 15 Sugar, Hydrogen
* Remove 30u Then 5u
* Add 25u Iodine, Phosphorus, Hydrogen
* Split Into 4 Bottles 25u Each (with ChemMaster or by hand)
* Heat Each Bottle Separately To >374°k NOTHING MORE NOTHING LESS
* Please Make Sure To Cool Other Chems to BELOW >380°k Before Adding The Meth

== [[Guide to chemistry#Krokodil|Krokodil]] ==

* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Remove '''15u'''
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Carbon, Bromine, Ethanol
* Remove '''30u''', then remove an additional '''15u'''
* Get a separate beaker
* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Water
* Remove '''15u'''
* Add '''15u''' of the resulting [[Guide to chemistry#Space Cleaner|Space Cleaner]] to the main beaker
* Add '''15u''' Potassium, Phosphorus, Welding Fuel)
* Add '''15u''' Morphine (Dispensed in the Nanomed Plus)
* Heat to >390°K

== [[Guide to chemistry#Aranesp|Aranesp]] ==

* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Water, Chlorine
* Remove '''30u'''
* Get a separate beaker
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Welding Fuel, Oxygen
* Remove '''30u'''
* Add '''15u''' of the resulting [[Guide to chemistry#Acetone|Acetone]] to the main beaker
* Get a separate beaker
* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Remove '''15u'''
* Add '''15u''' of the resulting [[Guide to chemistry#Diethylamine|Diethylamine]] to the main beaker
* Add '''15u''' Oxygen, Chlorine, Hydrogen
* Remove '''30u''', then remove an additional '''15u'''
* Get a separate beaker
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Welding Fuel, Oxygen
* Get a separate beaker
* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Add '''15u''' of the resulting [[Guide to chemistry#Diethylamine|Diethylamine]] to the beaker containing Acetone
* Get a separate beaker
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Water, Chlorine
* Remove '''30u'''
* Add '''15u''' of the resulting [[Guide to chemistry#Phenol|Phenol]] to the beaker containing Acetone
* Add '''15u''' of Ethanol, Sulphuric Acid
* Remove '''30u'''
* Add '''30u''' of the resulting [[Guide to chemistry#Atropine|Atropine]] to the main beaker
* Add '''30u''' Morphine (Dispensed in the Nanomed Plus)

Alternate:
* Add 30u of Epinephrine (from the Nanomed Plus)
* Add 30u of Morphine (from the Nanomed Plus)
* Get a Seperate Beaker
* Add '''10u''' Carbon, Hydrogen, Welding Fuel
* Remove '''10u'''
* Add '''10u''' Chlorine, Water, Welding Fuel, Oxygen
* Add '''15u''' Hydrogen, Ethanol
* Add '''5u''' Nitrogen
* Remove '''30u'''
* Add '''20u''' Ethanol, Sulphuric Acid
* Take 30u of the resulting Atropine and combine it with the Epinephrine and Morphine

== [[Guide to chemistry#Space Drugs|Space Drugs]] ==

* Add '''30u''' Lithium, Mercury, Sugar

=== [[Guide to chemistry#Fentanyl|Fentanyl]] ===

* Heat to >674°K

== [[Guide to chemistry#Bath Salts|Bath Salts]] ==

* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Water
* Remove '''20u'''
* Get a separate beaker
* Add '''5u''' Potassium, Nitrogen
* Add '''15u''' Oxygen
* Remove '''5u'''
* Add '''10u''' of the resulting [[Guide to chemistry#Saltpetre|Saltpetre]] to the beaker containing Space Cleaner
* Add '''10u''' Bad Food, (grind some human burgers) Nutriment, (grind some normal food, food from a vending machine will suffice) Tea, (found in the bartender's non-alcoholic drink dispenser) Universal Enzyme, (bug cargo, chef is going to be rather protective of the stuff), Mercury
* Heat to >374°K

== [[Guide to chemistry#Modafinil|Modafinil]] ==

* Add 5u Welding Fuel, Carbon, Hydrogen
* Remove 5u
* Add 5u Welding Fuel, Oxygen, Chlorine, Water
* Remove 10u
* Add 15u Hydrogen
* Add 5u Ethanol, Nitrogen
* Add 10u Sulfuric Acid, Bromine (catalyst)

= Manual Recipes for Toxins =
{{anchor|Toxins}}

== [[Guide to chemistry#Cyanide|Cyanide]] ==

* Add '''10u''' Welding Fuel, Carbon, Hydrogen, Nitrogen
* Add '''30u''' Hydrogen
* Add '''30u''' Oxygen
* Heat to >380°K

== [[Guide to chemistry#Heparin|Heparin]] ==

* Add '''10u''' Ethanol, Oxygen, Silver
* Heat to >420°K
* Remove '''5u'''
* Add '''25u''' Sodium, Chlorine, Lithium

== [[Guide to chemistry#Lipolicide|Lipolicide]] ==

* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Remove '''15u'''
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Sugar, Hydrogen
* Remove '''30u'''
* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Add '''30u''' Mercury

== [[Guide to chemistry#Mute Toxin|Mute Toxin]] ==

* Add '''25u''' Water, Carbon
* Add '''50u''' Uranium (found by grinding uranium ore sheets)

== [[Guide to chemistry#Sulfonal|Sulfonal]] ==

* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Welding Fuel, Oxygen
* Remove '''15u'''
* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Add '''30u''' Sulfur

== [[Guide to chemistry#Mulligan Toxin|Mulligan Toxin]] ==

* Add '''5u''' Chlorine, Phosphorus, Radium
* Use a dropper set to transfer 1u amounts to move '''2u''' of [[Guide to chemistry#Unstable Mutagen|Unstable Mutagen]] to another beaker
* Add '''1u''' Unstable Mutation Toxin, (found from injecting green slime extracts with radium, contact xenobiology) Blood

== [[Guide to chemistry#Mindbreaker Toxin|Mindbreaker Toxin]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Add '''30u''' Hydrogen, Silicon

== [[Guide to chemistry#Formaldehyde|Formaldehyde]] ==

* Add '''30u''' Ethanol, Oxygen, Silver
* Heat to >420°K

== [[Guide to chemistry#Zombie Powder|Zombie Powder]] ==

Probably the most powerful toxin in the game currently, 1u can incapacitate for 1 minute

Add '''30u''' of:
* Carpotoxin (can be found from Space Carp, [[Guide_to_hydroponics#Koibean|Koi Beans]], or Emagged Chem Dispensers)
* Morphine (found in nanomed plus)
* Copper

== [[Guide to chemistry#Itching Powder|Itching Powder]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Add '''30u''' Hydrogen
* Add '''10u''' Nitrogen
* Add '''30u''' Fuel (drag a fuel tank out of maintenance)

== [[Guide to chemistry#Miner's Salve|Miner's Salve]] ==

* Add '''10u''' Welding Fuel, Carbon, Hydrogen
* Add '''30u''' Iron, Water

== [[Guide to chemistry#Pax|Pax]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Add '''10u''' Sugar, Lithium, Water
* Add '''30u''' Water

== [[Guide to chemistry#Rotatium|Rotatium]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Remove '''20u'''
* Add '''10u''' Hydrogen, Silicon
* Get a separate beaker
* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to 480°K. Adding the following chemicals will cool the mix below the explosion threshold.
* Add '''10u''' Potassium, Nitrogen
* Add '''30u''' Oxygen
* Add '''30u''' Sulfur
* Remove '''50u''', then remove an additional '''30u'''
* Add '''10u''' Silver, Stable Plasma
* Heat to >400°K, but below 474°K
* Add '''30u''' of the resulting [[Guide to chemistry#Teslium|Teslium]] to the main beaker
* Get a separate beaker
* Add '''10u''' Lithium, Mercury, Sugar
* Heat to >674°K
* Add '''30u''' of the resulting [[Guide to chemistry#Neurotoxin|Neurotoxin]] to the main beaker

=== <s>[[Guide to chemistry#Skewium|Skewium]] </s>===
Skewium no longer exists.
* Remove '''50u'''
* Add '''40u''' of Plasma (grind some raw plasma)
* Add '''20u''' of Sulphuric Acid

== [[Guide to chemistry#Carbon Dioxide|Carbon Dioxide]] ==

* Add '''30u''' Carbon
* Add '''60u''' Oxygen
* Heat to >777°K

== Herbicides ==

=== [[Guide to chemistry#Weed Killer|Weed Killer]] ===

* Add '''60u''' Hydrogen
* Add '''20u''' Nitrogen
* Add '''30u''' Hydrogen
* Add '''10u''' Nitrogen
* Remove '''10u'''
* Add '''20u''' Toxin (found in hacked Nanomed Plus)

=== [[Guide to chemistry#Pest Killer|Pest Killer]] ===

* Add '''80u''' Ethanol
* Add '''20u''' Toxin (found in hacked Nanomed Plus)

=== [[Guide to chemistry#Plant-B-Gone|Plant-B-Gone]] ===

* Add '''80u''' Water
* Add '''20u''' Toxin (found in hacked Nanomed Plus)

= Manual Recipes for Utility =
{{anchor|Utility}}

== [[Guide_to_construction#Plastic|Plastic sheets]] ==
The main use for plastic sheets is making large water bottles - these are functionally identical to large beakers.

* Add 30 units each of Welding Fuel, Carbon and Hydrogen to a large beaker.
* This combines into [[Oil]]. Discard 10 units.
* Separate 30 units of [[Oil]], then heat the bottle to 1000°K until it turns to Ash.
* To the remaining [[Oil]], add 20 units [[Sulphuric Acid]].
* Add the Ash to the [[Oil]]/[[Sulphuric Acid]] mix.
* Now, heat the resulting mix to roughly 375°K.
* You now have enough [[Guide_to_construction#Plastic|Plastic]] sheets to make a lot of large bottles!

== Metal foam grenade ==
While not as elegant as smart foam, this one is great for dealing with AI turrets and containing [[Critter]] outbreaks.

* Make enough [[Fluorosulfuric Acid]] and [[Foaming Agent]] that you end up with 30u each.
* Fill beaker A with 90 units of Iron and insert into the grenade casing.
* Put 30u of [[Fluorosulfuric Acid]] and [[Foaming Agent]] each into beaker B and finish up the grenade.

== [[Guide to chemistry#Firefighting Foam|Firefighting Foam]] ==

* Add '''20u''' Carbon, Fluorine
* Add '''10u''' Sulphuric Acid
* Remove '''20u'''
* Add '''10u''' Iron, Oxygen, Hydrogen
* Add '''30u''' Carbon
* Cool to 200°K

= Manual Recipes for Virology =
{{anchor|Virology}}

== [[Guide to chemistry#Virus Food|Virus Food]] ==

* Add '''30u''' Water, Milk (found by using a Biogenerator. Or milk a goat or a cow. Or from [[File:Milk.png]] Space Milk cartons, 50 units in each. 5 are found in kitchen freezer. Ordered food crate has one.)

=== [[Guide to chemistry#Virus Rations|Virus Rations]] ===

* Remove '''30u''', then remove an additional '''15u'''
* Add '''15u''' Sugar, Lithium, Water

=== [[Guide to chemistry#Mutagenic Agar|Mutagenic Agar]] ===

* Remove '''30u''', then remove an additional '''15u'''
* Add '''15u''' Chlorine, Phosphorus, Radium

==== [[Guide to chemistry#Sucrose Agar|Sucrose Agar]] ====

* Remove '''30u''', then remove an additional '''10u'''
* Add '''50u''' of Sugar or Saline-Glucose Solution

=== [[Guide to chemistry#Virus Plasma|Virus Plasma]] ===

* Remove '''30u''', then remove an additional '''10u'''
* Add '''50u''' of Plasma (found when grinding plasma ore)

==== [[Guide to chemistry#Weakened Virus Plasma|Weakened Virus Plasma]] ====

* Remove '''30u''', then remove an additional '''15u'''
* Add '''15u''' Sugar, Lithium, Water

==== [[Guide to chemistry#Unstable Uranium Gel|Unstable Uranium Gel]] ====

* Remove '''50u''', then remove an additional '''25u'''
* Add '''50u''', then an additional '''25u''' of Uranium (found when grinding uranium ore)

=== [[Guide to chemistry#Decaying Uranium Gel|Decaying Uranium Gel]] ===

* Remove '''30u''', then remove an additional '''10u'''
* Add '''50u''' of Uranium (found when grinding uranium ore)

== [[Guide to chemistry#Stable Uranium Gel|Stable Uranium Gel]] ==

* Add '''30u''', then an additional '''10u''' of Silver, Uranium (found when grinding uranium ore)
* Add '''4u''' of Plasma (found when grinding plasma ore) using a dropper set to use 1u amounts

= 'Fun' =

== Carpet smoke grenade ==
Want to spruce up the station? Start throwing these grenades everywhere. Obscures vision for a while.

* Make 30 units of [[Space Drugs]] and extract 30u of Blood from someone.
* Beaker A: 30u [[Space Drugs]], 30u Potassium.
* Beaker B: 30u Phosphorus, 30u Blood, 30u Sugar.

== [[Guide to chemistry#Colorful Reagent|Colorful Reagent]] ==
Grab a spray bottle to mix.

'''Skip this part if you already have 60u Cryoxadone ready'''
* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''15u''' Oxygen, Welding Fuel
* Remove '''15u''' from the beaker
* Add '''10u''' Chlorine, Phosphorus, Radium
* Add '''30u''' Stable Plasma
* Remove '''30u''' from the beaker
--> '''60u''' Cryoxadone
* (Add '''60u''' Cryoxadone)
* Add '''20u''' Lithium, Mercury, Sugar
* Remove '''20u'''
--> '''50u''' Cryoxadone and Space Drugs
* Add '''10u''' Lemon+Lime+Orange Juice (Triple Citrus)
* Add '''50u''' Radium, Stable Plasma

== [[Guide to chemistry#Corgium|Corgium]] ==

'''Skip this part if you already have 15u Cryoxadone ready'''
* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''15u''' Oxygen, Welding Fuel
* Remove '''15u'''
* Add '''5u''' Chlorine, Phosphorus, Radium
* Add '''15u''' Stable Plasma
* Remove '''30u'''
-> '''15u''' Cryoxadone
* (Add '''15u''' Cryoxadone)
* Go to the bar, ask the bartender for some [[Guide to food and drinks#Triple Citrus|Triple Citrus]]. If the bartender isn't there, climb onto the table, and access the non-alcoholic drink dispenser. (It isn't ID locked!) Add '''5u''' Lemon Juice, Lime Juice, Orange Juice
* Add '''5u''' Lithium, Mercury, Sugar
* Add '''15u''' Stable Plasma, Radium
* Remove '''50u''', then remove an additional '''10u'''
* Get a separate beaker (a normal beaker which can hold 50u will do just fine, albeit by this point you should probably have bluespace beakers or large water bottles)
* Add '''5u''' Chlorine, Phosphorus, Raddium
* Remove '''10u'''
* Add '''5u''' Holy Water (get the chaplain to bless it for you)
* Add '''5u''' Omnizine (You can get omnizine through grinding heated donk pockets, or through nicely asking the botanist, since omnizine is naturally found in Ambrosia Deus. If you're lucky, the CMO starts the shift with his/her hypospray loaded with omnizine.)
* Add '''15u''' of the resulting [[Guide to chemistry#Strange Reagent|Strange Reagent]] to the original beaker
* Add '''15u''' of Nutriment (Just vend some food from the Getmore Chocolate Corp and grind it up)
* Get a separate beaker (normal beaker is aforementioned fine)
* Add '''15u''' of Blood
* Heat the beaker containing only blood to about 1000°K

'''How to maxcap the station with absolute adorableness'''

* Acquire a dropper, and adjust it to transfer in 1u amounts
* Go to your target destination
* Draw 1u of the heated blood (Solutions do not lose heat over time! The only way to change the temperature of a solution is by using a heater or a freezer.)
* Inject 1u of the heated blood into your other beaker. Every time 1u of blood is injected into the other beaker, an independent reaction occurs, which produces a corgi.
* Repeat. All your hard work will eventually lead to 15 corgis being let loose onto the station.

== [[Guide to chemistry#Life|Life]] ==

* Add '''5u''' Chlorine, Phosphorus, Radium
* Add '''15u''' Holy Water (Ask the chaplain to bless it for you, or ask the botanist for holymelons)
* Add '''15u''' Omnizine (Found in heated Donk Pockets, Ambrosia Deus, and in the CMO's hypospray)
* Remove '''15u'''
* Get a separate beaker for [[#Synthflesh|Synthflesh]] (this will need buffers, or it will fail)
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Remove '''10u'''
* Add '''5u''' Chlorine, Water
* Remove '''5u'''
* Add '''10u''' Nitrogen, Oxygen
* Add '''30u''' Carbon, Blood (or 5u Blood + 25u Unstable Mutagen)
* Add '''30u''' of the resulting Synthflesh to the main beaker
* Add '''30u''' Blood (for hostile life) or '''30u''' Sugar (for friendly life)
Heat beaker to at least 375K.

== [[Guide to chemistry#Quantum Hair Dye|Quantum Hair Dye]] ==

'''Skip this part if you already have 15u Cryoxadone ready'''
* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''15u''' Oxygen, Welding Fuel
* Remove '''15u'''
* Add '''5u''' Chlorine, Phosphorus, Radium
* Add '''15u''' Stable Plasma
* Remove '''30u'''
-> '''15u''' Cryoxadone
* (Add '''15u''' Cryoxadone)
* Go to the bar, ask the bartender for some [[Guide to food and drinks#Triple Citrus|Triple Citrus]]. If the bartender isn't there, climb onto the table, and access the non-alcoholic drink dispenser. (It isn't ID locked!) Add '''5u''' Lemon Juice, Lime Juice, Orange Juice
* Add '''5u''' Lithium, Mercury, Sugar
* Add '''15u''' Stable Plasma, Radium
* Remove '''30u''', then remove an additional '''15u'''
* Add '''10u''' Lithium, Mercury, Sugar
* Add '''30u''' Radium

== [[Guide to chemistry#Barber's Aid|Barber's Aid]] ==

* Add '''5u''' Lithium, Mercury, Sugar
* Add '''15u''' Blood
* Add '''10u''' Lithium, Mercury, Sugar
* Add '''30u''' Radium

=== [[Guide to chemistry#Concentrated Barber's Aid|Concentrated Barber's Aid]] ===

* Remove '''30u''' and then remove an additional '''15u'''
* Add '''15u''' Chlorine, Phosphorus, Radium

== [[Guide to chemistry#Condensed Capsaicin|Condensed Capsaicin]] ==

* Add '''15u''' of Capsaicin (bug botany for chilis)
* Add '''75u''' of Ethanol

== [[Guide to chemistry#Spray Tan|Spray Tan]] ==

* Add '''15u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Orange Juice (found in the bartender's non-alcoholic drink dispenser)

== [[Guide to chemistry#Nitrous Oxide|Nitrous Oxide]] ==

* Add '''30u''', and then an additional '''15u''' of Hydrogen
* Add '''15u''' of Nitrogen
* Remove '''5u'''
* Add '''20u''' Nitrogen
* Add '''40u''' Oxygen
* Heat to 525°K

Note: Nitrous Oxide explodes at 575°K

== [[Guide to chemistry#Laughter|Laughter]] ==

A suitable substitute gift for the clown. Unlike Space Lube, will most likely not get you lynched.

* Add '''50u''' Sugar, Banana Juice (can only be acquired through juicing raw bananas, which can be found in botany)

== [[Guide to chemistry#Synthmeat|Synthmeat]] ==

'''Skip this part if you already have 15u Cryoxadone ready'''
* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''15u''' Oxygen, Welding Fuel
* Remove '''15u'''
* Add '''5u''' Chlorine, Phosphorus, Radium
* Add '''15u''' Stable Plasma
* Remove '''30u'''
-> '''15u''' Cryoxadone
* (Add '''15u''' Cryoxadone)
* Add '''75u''' Blood

== [[Guide to chemistry#Carpet|Carpet]] ==

* Add '''15u''' Lithium, Mercury, Sugar
* Add '''45u''' Blood

[[Category:Guides]][[Category:Chemistry]]

Химические рецепты

2026-03-03T10:06:15Z

Krytoi: Переведено начало страницы

{{Требуется перевод}}
Устали жонглировать бутылками при смешивании сложных химикатов?

Если не указано иначе, предполагается что вы будете использовать 100u ёмкость (Большой бикер/большая бутылка воды/шейкер и т. д.)

= Запись Химических Рецептов =
{{anchor|Chemical Macros}}Вы можете записывать рецепты кликая по раздатчикам хим/бухла/напитков кликая "Record Recipe". Затем налейте реагентов которых хотите и кликните "Save". Посмотрите пример на гифке: 
[[File:JJRcops_chem_recording_example.gif]]
= Химические Макросы =
Август 2019, макросы были удалены с /tg/station, и были заменены с записью рецептов. Таблица оставлена для других станций использующих старый /tg/code.

<div class="toccolours mw-collapsible mw-collapsed">
Кликните что бы развернуть таблицу:
<div class="mw-collapsible-content">
You can save recipes in the chem dispenser to instantly dispense a certain combination of chemicals at the touch of a button at the remaining cost of dispenser power.

Recipes are tied to a specific Chem Dispenser, and anyone using that dispenser will be able to see, use and erase recipes in it. You also cannot remove individual recipes, as the dispenser only allows you to add recipes and erase all recipes saved.

You can give your recipe any name, and you enter the ingredients in the format <code><ingredient_id>=<amount></code>, separated by semicolons.
For example:
{|
|----
|<code>oxygen=20;nitrogen=15;carbon=10</code>
|-
|<code>water=100</code>
|-
|<code>sulfur=10;ethanol=50</code>
|----
|}

If your recipe doesn't appear in the chem dispenser menu, then you've most likely entered it incorrectly, so try again.
{| class="wikitable sortable" style="width:35%; text-align:left; border: 3px solid #FFDD66; cellspacing=0; cellpadding=2; background-color:white;"
|+ style="caption-side:bottom|"Dispenser Reagents"
! scope="col" style='width:70px; background-color:#FFDD66;'|Name
! scope="col" class="unsortable" style='background-color:#FFDD66;'|Ingredient ID
|-
|Welding Fuel
|welding_fuel
|-
|Stable Plasma
|stable_plasma
|-
|Carbon Dioxide
|co2
|-
|Oxygen
|oxygen
|-
|Hydrogen
|hydrogen
|-
|Nitrogen
|nitrogen
|-
|Chlorine
|chlorine
|-
|Fluorine
|fluorine
|-
|Mercury
|mercury
|-
|Sulfur
|sulfur
|-
|Sulphuric acid
|sacid
|-
|Silicon
|silicon
|-
|Iodine
|iodine
|-
|Ethanol
|ethanol
|-
|Bromine
|bromine
|-
|Radium
|radium
|-
|Lithium
|lithium
|-
|Phosphorus
|phosphorus
|-
|Sodium
|sodium
|-
|Sugar
|sugar
|-
|Silver
|silver
|-
|Iron
|iron
|-
|Copper
|copper
|-
|Aluminum
|aluminum
|-
|Space Drugs
|space_drugs
|-
|Morphine
|morphine
|-
|Miner's Salve
|mine_salve
|-
|Toxin
|toxin
|-
|Carpotoxin
|carpotoxin
|}
</div>
</div>



== Полезные макросы игроков ==
'''Больше не могут быть использованы на /tg/station.''' 

Кликните [https://docs.google.com/spreadsheets/d/12vRyMwELUs-dlXZN5jtBHTzW2SyXln47KEhT8nDbuzI/edit?usp=sharing this spreadsheet] для большого списка макросов созданных игроками. Упразднено Июля 21 2019. 

'''Old/outdated list below:''' Many of the following macros are outdated and no longer work. Some of them may only work at a later tech level since you need to upgrade the manipulators in the machine to dispense less than 5u (down to 1u minimum).

<div class="toccolours mw-collapsible mw-collapsed">
Click expand to see the list:
<div class="mw-collapsible-content">
* Oil (3u): welding_fuel=1;carbon=1;hydrogen=1
* Phenol(9u): welding_fuel=1;carbon=1;hydrogen=1;water=3;chlorine=3
* Acetone (9u): welding_fuel=4;carbon=1;hydrogen=1;oxygen=3

* Diethylamine (60u): hydrogen=30;nitrogen=10;ethanol=30
* Saltpetre (30u): potassium=10;nitrogen=10;oxygen=30
* Unstable Mutagen (90u): chlorine=30;phosphorus=30;radium=30

* Silver Sulfadiazine (90u): hydrogen=18;nitrogen=6;silver=18;sulfur=18;oxygen=18;chlorine=18
* Styptic Powder (100u): aluminium=25;hydrogen=25;oxygen=25;sacid=25
* Saline Glucose (90u): sodium=10;chlorine=10;water=40;sugar=30
* Tricordrazine(90u): nitrogen=10;silicon=25;potassium=10;carbon=25;oxygen=10;sugar=10
* Cryoxadone (90u): chlorine=10;phosphorus=10;radium=10;welding_fuel=14;carbon=4;hydrogen=4;oxygen=10;stable_plasma=30
* Clonexadone (add 5u of plasma): chlorine=5;phosphorus=5;radium=5;welding_fuel=7;carbon=2;hydrogen=2;oxygen=5;stable_plasma=15;sodium=45
* Mannitol(99u): hydrogen=33;water=33;sugar=33
* Salicylic Acid(45u): welding_fuel=1;carbon=10;hydrogen=1;water=3;chlorine=3;sodium=9;oxygen=9;sacid=9
* Oxandrolone (54u): welding_fuel=1;carbon=28;hydrogen=10;water=3;chlorine=3;oxygen=9
* Perfluorodecalin (heat to 370): hydrogen=4;fluorine=3;welding_fuel=1;carbon=1
* Atropine(45u): sacid=9;welding_fuel=5;carbon=2;hydrogen=8;oxygen=3;water=3;chlorine=3;ethanol=15;nitrogen=2
* Mutadone (90u): chlorine=10;phosphorus=10;radium=10;welding_fuel=14;carbon=4;hydrogen=4;oxygen=10;bromine=30

* Ephedrine(24u): hydrogen=11;nitrogen=1;ethanol=3;sugar=6;welding_fuel=2;carbon=2
* Epinephrine (54u): welding_fuel=5;carbon=2;hydrogen=17;water=3;oxygen=12;chlorine=12;nitrogen=2;ethanol=6
* Diphenhydramine (24u): welding_fuel=2;carbon=8;hydrogen=5;bromine=6;nitrogen=1;ethanol=9
* Synaptizine(30u): sugar=10;lithium=10;water=10
* Spaceacillin(60u): welding_fuel=5;carbon=2;hydrogen=17;water=3;oxygen=22;chlorine=12;nitrogen=2;ethanol=6;potassium=10;sugar=10
* Haloperidol(45u): welding_fuel=3;carbon=3;hydrogen=3;potassium=5;iodine=5;aluminium=9;fluorine=9;chlorine=9
* Pentetic acid(54u): stable_plasma=1;radium=1;phosphorus=1;welding_fuel=4;carbon=4;hydrogen=16;nitrogen=4;oxygen=14;oxygen=12;ethanol=12;silver=12;oxygen=10;oxygen=12;hydrogen=36;nitrogen=12;sodium=36;chlorine=36;welding_fuel=36

* Methamphetamine(Heat to 374): hydrogen=35;nitrogen=1;ethanol=3;sugar=6;welding_fuel=2;carbon=2;iodine=24;phosphorus=24
* Space Drugs (30u): lithium=10;mercury=10;sugar=10

* Napalm(9u): welding_fuel=4;carbon=1;hydrogen=1;ethanol=3

* Space Cleaner (18u): nitrogen=3;hydrogen=9;water=9
* Space Lube (12u): oxygen=3;silicon=3;water=3

* Chloral Hydrate(20u): chlorine=60;ethanol=20;water=20
* Sulfonal(27u): welding_fuel=4;carbon=1;hydrogen=7;oxygen=3;nitrogen=2;ethanol=6;sulfur=9
* Lipolicide (36u): hydrogen=17;nitrogen=3;ethanol=9;sugar=6;welding_fuel=2;carbon=2;mercury=12
* Formaldehyde(9u, heat to 420): ethanol=3;oxygen=3;silver=3
* Fentanyl(30u, heat to 674): lithium=10;mercury=10;sugar=10
* Cyanide (9u): welding_fuel=1;carbon=1;hydrogen=4;nitrogen=1;oxygen=3
* Heparin (60u, heat to 420): ethanol=5;oxygen=5;silver=5;sodium=15;chlorine=15;lithium=15

* Antihol + Inacusiate + Oculine Step 01/02: sodium=5;chlorine=5;water=5;welding_fuel=5;carbon=5;hydrogen=5
* Antihol + Inacusiate + Oculine Step 02/02: carbon=20;ethanol=10;copper=10;water=10;hydrogen=10 //then heat the mix
* Fluorosulfuric Acid (100u): fluorine=25;hydrogen=25;potassium=25;sacid=25 //then heat the mix
</div>
</div>
 

= Manual Recipes for Drinks =
{{anchor|Drinks}}
Here follows a list of simplified step-by-step instructions to mix drinks and change lives. Anyone can edit the wiki page to add additional recipes or update outdated ones.

== [[Guide_to_drinks#Bacchus'_Blessing|Bacchus' Blessing]][[File:Bacchus_blessing.png|64px]] ==

Acquire '''5u''' Universal Enzyme and a bottle of Absinthe. 
Universal Enzyme is found in the kitchen or ordered at Cargo.
*Add '''60u''' Ethanol, '''30u''' Welder Fuel, '''5u''' Universal Enzyme (catalyst)
*Remove Universal Enzyme, set beaker aside
*Add '''25u''' Beer, '''20u''' Ale, '''10u''' Whiskey
*Add '''5u''' Cola
*Remove '''10u'''
*Add '''25u''' Hooch+Absinthe

== [[Guide_to_drinks#Hearty_Punch|Hearty Punch]][[File:Hearty_punch.png|64px]] ==

You'll need a spray bottle to mix this - most maps start with a bunch in the medical area. 

Grab a bottle of Absinthe and Kahlua from the bar fridge
* Add '''60u''' Beer, '''40u''' Whiskey, '''20u''' Cola
* Remove '''45u'''
* Add '''50u''' Tequila, '''25u''' Kahlua
* Add '''75u''' Absinthe
* Heat to >315°K
-> Results in '''15u'''

== [[Guide to food and drinks#Neurotoxin|Neurotoxin]][[File:Neurotoxin.gif|64px]] ==

Neurotoxin is also a very good toxin.

* Add '''10u''' Gin, Vodka, Whiskey, Cognac, Lime Juice
* Add '''50u''' Morphine (found in Nanomed Plus)

== [[Guide to food and drinks#Changeling Sting|Changeling Sting]][[File:ChangelingSting.gif|64px]] ==

* Add '''20u''' Vodka
* Add '''10u''' Orange Juice
* Add '''50u''', then an additional '''10u''' of Lemon-Lime

* You probably want to disguise the drink, lest you get beaten up by security.
* Remove '''40u''', then remove an additional '''5u'''
* Add '''50u''', the an additional '''5u''' of [[Guide to food and drinks#Basic Drink Ingredients|whatever.]] The main point is to disguise the cocktail.

== [[Guide to food and drinks#Bahama Mama|Bahama Mama]][[File:Bahamamamaglass.gif|64px]] ==

* Add '''30u''' Rum, Orange Juice
* Add '''15u''' Lime Juice, Ice

== [[Guide to food and drinks#Cuba Libre|Cuba Libre]][[File:CubaLibre.png|64px]] ==

* Add '''30u''' Space Cola (found in Booze-O-Mat)
* Add '''60u''' Rum

== [[Guide to food and drinks#Demons Blood|Demons Blood]][[File:Demonsbloodglass.gif|64px]] ==

* Add '''25u''' Space Mountain Wind, Dr. Gibb (both found in Robust Softdrinks), Rum, Blood

== [[Guide to food and drinks#Doctor's Delight|Doctor's Delight]][[File:DoctorDelight.gif|64px]] ==

'''Skip this part if you already have 20u Cryoxadone ready'''
* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''15u''' Oxygen, Welding Fuel
* Remove '''15u'''
* Add '''5u''' Chlorine, Phosphorus, Radium
* Add '''15u''' Stable Plasma
* Remove '''25u'''
-> '''20u''' Cryoxadone
* Add '''20u''' Lime Juice, Tomato Juice, Orange Juice, Milk Cream (found in Booze-O-Mat)

== [[Guide to food and drinks#Fetching Fizz|Fetching Fizz]][[File:Fetching_fizz.png|64px]] ==

* Add '''60u''' Space Cola
* Add '''10u''' Uranium (found by grinding uranium ore sheets)
* Remove '''20u'''
* Add '''50u''' Iron

== [[Guide to food and drinks#Three Mile Island Iced Tea|Three Mile Island Iced Tea]][[File:Threemileislandglass.gif|64px]] ==

* Add '''5u''' Space Cola (found in Booze-O-Mat)
* Add '''10u''' Rum
* Add '''15u''' Vodka, Gin, Tequila
* Remove '''10u'''
* Add '''10u''' Uranium (found by grinding uranium ore sheets)

== [[Guide to food and drinks#Telepole|Telepole]][[File:TelepoleGlass.png|alt=|64x64px]] ==

* Add '''35u''' Sol Dry
* Add '''15u''' Rum
* Add '''25u''' Voltaic Yellow Wine (found in Booze-O-Mat)
* Add '''25u''' Sake

== [[Guide to food and drinks#Pod Tesla|Pod Tesla]][[File:PodTeslaGlass.png|alt=|64x64px]] ==

Skip to step 5 if you already have telepole

* Add '''35u''' Sol Dry
* Add '''15u''' Rum
* Add '''25u''' Voltaic Yellow Wine (found in Booze-O-Mat)
* Add '''25u''' Sake
* Get a Second Glass bottle from Booze-O-Mat
* Add '''60u''' Navy Rum
* Add '''20u''' Vermouth
* Add '''20u''' Fernet (found in [[Hacking|hacked]] Booze-O-Mat)
* Get a Third Glass Bottle
* Add '''5u''' Kahlua
* Add '''10u''' Tequila
* Add '''25u''' of telepole from Bottle 1
* Add '''25u''' of admiralty from Bottle 2
* Repeat the last 4 steps until Bottles 1 and 2 are empty

== [[Guide to food and drinks#Atomic Bomb|Atomic Bomb]][[File:Atomicbombglass.gif|64px]] ==

* Add '''20u''' Whiskey
* Add '''10u''' Milk Cream (found in Booze-O-Mat)
* Add '''30u''' Kahlúa, Cognac
* Remove '''30u''', then remove an additional '''10u'''
* Add '''10u''' Uranium (found by grinding uranium ore sheets)

= Manual Recipes for Medicines =
{{anchor|Medicines}}

== [[Cryoxadone]] and [[Mutadone]] ==
* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''15u''' Oxygen, Welding Fuel
* Remove '''15u''' from the beaker
* Add '''10u''' Chlorine, Phosphorus, Radium
* [[Mutadone]]: Add '''30u''' Bromine
* [[Cryoxadone]]: Add '''30u''' Stable Plasma

=== [[Guide to chemistry#Clonexadone|Clonexadone]] ===
* Remove '''40u''', then remove an additional '''5u''' of the [[Guide to chemistry#Cryoxadone|Cryoxadone]]
* Add '''40u''', then an additional '''5u''' of Sodium
* Add '''5u''' of Plasma (Chemistry starts the shift with some plasma on the desk. Grind the plasma up!)

== [[Atropine]] ==
* Add '''10u''' Carbon, Hydrogen, Welding Fuel
* Remove '''10u'''
* Add '''10u''' Chlorine, Water, Welding Fuel, Oxygen
* Add '''15u''' Hydrogen, Ethanol
* Add '''5u''' Nitrogen
* Remove '''30u'''
* Add '''20u''' Ethanol, Sulphuric Acid

== [[Pentetic Acid]] ==
* Add '''5u''' Carbon, Hydrogen, Nitrogen, Welding Fuel
* Add '''15u''' Hydrogen, Oxygen
* Remove '''30u'''
* Heat to 380°K
* Add '''5u''' Ethanol, Oxygen, Silver
* Heat to >420°K
* Add '''5u''' Nitrogen
* Add '''15u''' Chlorine, Hydrogen, Sodium, Welding Fuel

== [[Salbutamol]] ==

* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Remove '''10u'''
* Add '''5u''' Chlorine, Water
* Remove '''5u'''
* Add '''10u''' Carbon, Oxygen, Sulphuric Acid, Sodium
* Remove '''20u'''
* Add '''30u''' Hydrogen
* Add '''10u''' Nitrogen
* Remove '''20u'''
* Add '''20u''' Aluminum, Bromine, Lithium

== [[Epinephrine]] ==

* Add '''15u''' Ethanol+Hydrogen, '''5u''' Nitrogen
* Remove '''15u'''
* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''5u''' Chlorine, Oxygen, Water, Welding Fuel
* Add '''15u''' Chlorine, Hydrogen, Oxygen
* Remove '''5u''' Oil with ChemMaster

== [[Synthflesh]] ==
For 90u, impure Synthflesh (''very'' likely to heal inefficiently):
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Remove '''10u'''
* Add '''5u''' Chlorine, Water
* Remove '''5u'''
* Add '''10u''' Nitrogen, Oxygen
* Add '''30u''' Carbon, Blood (or 5u Blood + 25u Unstable Mutagen)

== [[Guide to chemistry#Anacea|Anacea]] ==

* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Remove '''5u'''
* Add '''5u''' Potassium, Iodine
* Add '''10u''' Chlorine, Fluorine, Aluminum
* Remove '''20u'''
* Add '''15u''' Mercury, Oxygen, Sugar
* Add '''30u''' Radium

== [[Guide to chemistry#Sulfonal|Sulfonal]] ==

* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Remove '''5u'''
* Add '''10u''' Welding Fuel, Oxygen
* Add '''15u''' Hydrogen, Ethanol
* Add '''5u''' Nitrogen
* Add '''30u''' Sulfur

== [[Guide to chemistry#Antihol|Antihol]] + [[Inacusiate]] + [[Oculine]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''20u''' Carbon
* Add '''10u''' Ethanol, Copper, Water, Hydrogen
* Heat to >480°K

== [[Guide to chemistry#Antihol|Antihol]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Add '''15u''' Ethanol, Copper

== [[Guide to chemistry#Inacusiate|Inacusiate]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Add '''15u''' Carbon, Water

== [[Guide to chemistry#Oculine|Oculine]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Add '''15u''' Carbon, Hydrogen

== [[Guide to chemistry#Salicyclic Acid|Salicyclic Acid]] ==

* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Water, Chlorine
* Remove '''20u''', then remove an additional '''5u'''
* Add '''20u''' Sodium, Carbon, Oxygen, Sulphuric Acid

== [[Guide to chemistry#Oxandrolone|Oxandrolone]] ==

* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Water, Chlorine
* Remove '''30u'''
* Add '''45u''' Carbon
* Add '''15u''' Hydrogen, Oxygen

== [[Guide to chemistry#Strange Reagent|Strange Reagent]] ==

* Add '''10u''' Chlorine, Phosphorus, Radium
* Add '''30u''' Holy Water (Ask the chaplain to bless it for you)
* Add '''30u''' Omnizine (Found in heated Donk Pockets, Ambrosia Deus, and in the CMO's hypospray)

== [[Guide to chemistry#Haloperidol|Haloperidol]] ==

* Add '''10u''' Welding Fuel, Carbon, Hydrogen
* Remove '''10u'''
* Add '''10u''' Potassium, Iodine
* Add '''20u''' Chlorine, Fluorine, Aluminum

== [[Guide to chemistry#Rezadone|Rezadone]] ==

* Carpotoxin, an ingredient in Rezadone, can only be found from Space Carp, Koi Beans, or Emagged Chem Dispensers

* Add '''10u''' Oxygen, Potassium, Sugar
* Add '''30u''' [[Guide to chemistry#Carpotoxin|Carpotoxin]]
* Add '''30u''' Copper

== [[Guide to chemistry#Saline-Glucose Solution|Saline-Glucose Solution]] ==

* Add '''10u''' Sodium, Chlorine, Water
* Add '''30u''' Water, Sugar

==[[Guide to chemistry#Multiver|Multiver]] (previously [[Guide to chemistry#Charcoal|Charcoal]])==
* Add '''15u''' Sodium, Chlorine, Water
* Add '''15u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K

== [[Guide to chemistry#Spaceacillin|Spaceacillin]] ==

* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Remove '''20u'''
* Get a separate beaker
* Add '''10u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Welding Fuel, Oxygen, Water, Chlorine
* Remove '''70u'''
* Add '''20u''' of the resulting [[Guide to chemistry#Acetone|Acetone]] and [[Guide to chemistry#Phenol|Phenol]] to the main beaker
* Add '''10u''' Oxygen, Chlorine, Hydrogen
* Remove '''15u'''
* Add '''15u''' Oxygen, Potassium, Sugar

== [[Guide to chemistry#Higadrite|Higadrite]] ==

* Add '''10u''' Welding Fuel, Carbon, Hydrogen
* Remove '''10u'''
* Add '''20u''' Water, Chlorine
* Add '''30u''' Lithium

== [[Guide to chemistry#Leporazine|Leporazine]] ==

* Add '''45u''' Copper, Silicon
* Add '''5u''' Plasma (found in grinded sheets of plasma ore)

== [[Guide to chemistry#Diphenhydramine|Diphenhydramine]] ==

* Add '''30u''' Hydrogen
* Add '''10u''' Nitrogen
* Remove '''10u'''
* Get a separate beaker
* Add '''10u''' Welding Fuel, Carbon, Hydrogen
* Remove '''10u'''
* Add '''20u''' of the resulting [[Guide to chemistry#Oil|Oil]] to the main beaker
* Add '''20u''' Carbon, Bromine, Ethanol

== [[Guide to chemistry#Lenturi|Lenturi]] (Previously [[Guide to chemistry#Ichiyuri|Ichiyuri]]) ==
(Ichiyuri is now a failed chem acquired from failing to make Lenturi.)

* Add '''30u''' Hydrogen
* Add '''10u''' Nitrogen
* Remove '''10u'''
* Add '''20u''' Silver, Sulfur, Oxygen, Chlorine

== [[Guide to chemistry#Ephedrine|Ephedrine]] ==

* Add '''15u''' Hydrogen, Ethanol
* Add '''5u''' Nitrogen
* Add '''10u''' Welding Fuel, Carbon, Hydrogen
* Remove '''10u'''
* Add '''25u''' Sugar, Hydrogen

== [[Guide to chemistry#Sterilizine|Sterilizine]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Add '''30u''' Chlorine, Ethanol

== [[Guide to chemistry#Pyroxadone|Pyroxadone]] ==

* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''15u''' Oxygen, Welding Fuel
* Remove '''15u''' from the beaker
* Add '''10u''' Chlorine, Phosphorus, Radium
* Add '''30u''' Stable Plasma
* Remove '''45u'''
* Add '''45u''' [[Guide to chemistry#Slime Jelly|Slime Jelly]]

== [[Guide to chemistry#Energized Jelly|Energized Jelly]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to 480°K. Adding the following chemicals will cool the mix below the explosion threshold.
* Add '''10u''' Potassium, Nitrogen
* Add '''30u''' Oxygen
* Add '''30u''' Sulfur
* Remove '''50u''', then remove an additional '''20u''' and '''5u'''
* Add '''15u''' Stable Plasma, Silver
* Heat to 400°K
* Add '''45u''' [[Guide to chemistry#Slime Jelly|Slime Jelly]]

= Manual Recipes for Pyrotechnics =
{{anchor|Pyrotechnics}}

== [[Guide to chemistry#Gunpowder|Gunpowder]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to 481°K. Adding the following chemicals will cool the mix below the explosion threshold.
* Add '''10u''' Potassium, Nitrogen
* Add '''30u''' Oxygen
* Add '''30u''' Sulfur

Note: Gunpowder ignites at 474°K.

== [[Guide to chemistry#Nitroglycerin|Nitroglycerin]] ==

* Add '''30u''' Corn Oil (bug botany)
* Add '''10u''' Sulphuric Acid
* Remove '''10u'''
* Get a separate beaker
* Add '''10u''' Fluorine, Hydrogen, Potassium, Sulphuric Acid
* Heat to >380°K
* Remove '''10u'''
* Add '''30u''' of the resulting [[Guide to chemistry#Fluorosulfuric Acid|Fluorosulfuric Acid]] to the main beaker
* Get a separate beaker
* Add '''5u''' Iron, Oxygen, Hydrogen
* Use a dropper to draw '''1u''' of the resulting [[Guide to chemistry#Stabilizing Agent|Stabilizing Agent]] to the main beaker
* Dispose of the separate beaker
* Add '''30u''' Sulphuric Acid

* Heat to >474°K for the solution to explode

== [[Guide to chemistry#Napalm|Napalm]] ==

* Add '''10u''' Welding Fuel, Carbon, Hydrogen
* Add '''30u''' Welding Fuel, Ethanol

== [[Guide to chemistry#Meth Explosion|Meth Explosion]] ==

* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Remove '''5u'''
* Add '''25u''' Iodine Phosphorus
* Cool to about 0°K using the space heater
* Add '''25u''' Hydrogen

* Heat to 300°K (room temperature) to activate an explosion

== [[Guide to chemistry#Teslium|Teslium]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to 480°K. Adding the following chemicals will cool the mix below the explosion threshold.
* Add '''10u''' Potassium, Nitrogen
* Add '''30u''' Oxygen
* Add '''30u''' Sulfur
* Remove '''50u''', then remove an additional '''20u''' and '''5u'''
* Add '''15u''' Stable Plasma, Silver
* Heat to 400°K

* Heat to >474°K to activate an explosion

== [[Guide to chemistry#Chlorine Trifluoride|Chlorine Trifluoride]] ==

* Add '''50u''', then add an additional '''25u''' Fluorine
* Add '''25u''' Chlorine
* Heat to >424°K

== [[Guide to chemistry#Fluorosulfuric Acid|Fluorosulfuric Acid]] ==

* Add '''25u''' Fluorine, Hydrogen, Potassium, Sulphuric Acid
* Heat to >380°K

= Manual Recipes for Drugs =
{{anchor|Drugs}}

== [[Guide to chemistry#Morphine|Morphine]] ==

* Add '''30u''' Carbon, Hydrogen
* Add '''15u''' Ethanol, Oxygen
* Heat to >480K

== [[Guide to chemistry#Methamphetamine|Meth]] ==

* Add 15u Hydrogen
* Add 5u Nitrogen
* Add 15u Ethanol
* Remove 15u
* Add 5u Welding Fuel, Carbon, Hydrogen
* Add 15 Sugar, Hydrogen
* Remove 30u Then 5u
* Add 25u Iodine, Phosphorus, Hydrogen
* Split Into 4 Bottles 25u Each (with ChemMaster or by hand)
* Heat Each Bottle Separately To >374°k NOTHING MORE NOTHING LESS
* Please Make Sure To Cool Other Chems to BELOW >380°k Before Adding The Meth

== [[Guide to chemistry#Krokodil|Krokodil]] ==

* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Remove '''15u'''
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Carbon, Bromine, Ethanol
* Remove '''30u''', then remove an additional '''15u'''
* Get a separate beaker
* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Water
* Remove '''15u'''
* Add '''15u''' of the resulting [[Guide to chemistry#Space Cleaner|Space Cleaner]] to the main beaker
* Add '''15u''' Potassium, Phosphorus, Welding Fuel)
* Add '''15u''' Morphine (Dispensed in the Nanomed Plus)
* Heat to >390°K

== [[Guide to chemistry#Aranesp|Aranesp]] ==

* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Water, Chlorine
* Remove '''30u'''
* Get a separate beaker
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Welding Fuel, Oxygen
* Remove '''30u'''
* Add '''15u''' of the resulting [[Guide to chemistry#Acetone|Acetone]] to the main beaker
* Get a separate beaker
* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Remove '''15u'''
* Add '''15u''' of the resulting [[Guide to chemistry#Diethylamine|Diethylamine]] to the main beaker
* Add '''15u''' Oxygen, Chlorine, Hydrogen
* Remove '''30u''', then remove an additional '''15u'''
* Get a separate beaker
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Welding Fuel, Oxygen
* Get a separate beaker
* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Add '''15u''' of the resulting [[Guide to chemistry#Diethylamine|Diethylamine]] to the beaker containing Acetone
* Get a separate beaker
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Water, Chlorine
* Remove '''30u'''
* Add '''15u''' of the resulting [[Guide to chemistry#Phenol|Phenol]] to the beaker containing Acetone
* Add '''15u''' of Ethanol, Sulphuric Acid
* Remove '''30u'''
* Add '''30u''' of the resulting [[Guide to chemistry#Atropine|Atropine]] to the main beaker
* Add '''30u''' Morphine (Dispensed in the Nanomed Plus)

Alternate:
* Add 30u of Epinephrine (from the Nanomed Plus)
* Add 30u of Morphine (from the Nanomed Plus)
* Get a Seperate Beaker
* Add '''10u''' Carbon, Hydrogen, Welding Fuel
* Remove '''10u'''
* Add '''10u''' Chlorine, Water, Welding Fuel, Oxygen
* Add '''15u''' Hydrogen, Ethanol
* Add '''5u''' Nitrogen
* Remove '''30u'''
* Add '''20u''' Ethanol, Sulphuric Acid
* Take 30u of the resulting Atropine and combine it with the Epinephrine and Morphine

== [[Guide to chemistry#Space Drugs|Space Drugs]] ==

* Add '''30u''' Lithium, Mercury, Sugar

=== [[Guide to chemistry#Fentanyl|Fentanyl]] ===

* Heat to >674°K

== [[Guide to chemistry#Bath Salts|Bath Salts]] ==

* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Water
* Remove '''20u'''
* Get a separate beaker
* Add '''5u''' Potassium, Nitrogen
* Add '''15u''' Oxygen
* Remove '''5u'''
* Add '''10u''' of the resulting [[Guide to chemistry#Saltpetre|Saltpetre]] to the beaker containing Space Cleaner
* Add '''10u''' Bad Food, (grind some human burgers) Nutriment, (grind some normal food, food from a vending machine will suffice) Tea, (found in the bartender's non-alcoholic drink dispenser) Universal Enzyme, (bug cargo, chef is going to be rather protective of the stuff), Mercury
* Heat to >374°K

== [[Guide to chemistry#Modafinil|Modafinil]] ==

* Add 5u Welding Fuel, Carbon, Hydrogen
* Remove 5u
* Add 5u Welding Fuel, Oxygen, Chlorine, Water
* Remove 10u
* Add 15u Hydrogen
* Add 5u Ethanol, Nitrogen
* Add 10u Sulfuric Acid, Bromine (catalyst)

= Manual Recipes for Toxins =
{{anchor|Toxins}}

== [[Guide to chemistry#Cyanide|Cyanide]] ==

* Add '''10u''' Welding Fuel, Carbon, Hydrogen, Nitrogen
* Add '''30u''' Hydrogen
* Add '''30u''' Oxygen
* Heat to >380°K

== [[Guide to chemistry#Heparin|Heparin]] ==

* Add '''10u''' Ethanol, Oxygen, Silver
* Heat to >420°K
* Remove '''5u'''
* Add '''25u''' Sodium, Chlorine, Lithium

== [[Guide to chemistry#Lipolicide|Lipolicide]] ==

* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Remove '''15u'''
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Sugar, Hydrogen
* Remove '''30u'''
* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Add '''30u''' Mercury

== [[Guide to chemistry#Mute Toxin|Mute Toxin]] ==

* Add '''25u''' Water, Carbon
* Add '''50u''' Uranium (found by grinding uranium ore sheets)

== [[Guide to chemistry#Sulfonal|Sulfonal]] ==

* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Welding Fuel, Oxygen
* Remove '''15u'''
* Add '''15u''' Hydrogen
* Add '''5u''' Nitrogen
* Add '''15u''' Ethanol
* Add '''30u''' Sulfur

== [[Guide to chemistry#Mulligan Toxin|Mulligan Toxin]] ==

* Add '''5u''' Chlorine, Phosphorus, Radium
* Use a dropper set to transfer 1u amounts to move '''2u''' of [[Guide to chemistry#Unstable Mutagen|Unstable Mutagen]] to another beaker
* Add '''1u''' Unstable Mutation Toxin, (found from injecting green slime extracts with radium, contact xenobiology) Blood

== [[Guide to chemistry#Mindbreaker Toxin|Mindbreaker Toxin]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Add '''30u''' Hydrogen, Silicon

== [[Guide to chemistry#Formaldehyde|Formaldehyde]] ==

* Add '''30u''' Ethanol, Oxygen, Silver
* Heat to >420°K

== [[Guide to chemistry#Zombie Powder|Zombie Powder]] ==

Probably the most powerful toxin in the game currently, 1u can incapacitate for 1 minute

Add '''30u''' of:
* Carpotoxin (can be found from Space Carp, [[Guide_to_hydroponics#Koibean|Koi Beans]], or Emagged Chem Dispensers)
* Morphine (found in nanomed plus)
* Copper

== [[Guide to chemistry#Itching Powder|Itching Powder]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Add '''30u''' Hydrogen
* Add '''10u''' Nitrogen
* Add '''30u''' Fuel (drag a fuel tank out of maintenance)

== [[Guide to chemistry#Miner's Salve|Miner's Salve]] ==

* Add '''10u''' Welding Fuel, Carbon, Hydrogen
* Add '''30u''' Iron, Water

== [[Guide to chemistry#Pax|Pax]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Add '''10u''' Sugar, Lithium, Water
* Add '''30u''' Water

== [[Guide to chemistry#Rotatium|Rotatium]] ==

* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to >480°K
* Remove '''20u'''
* Add '''10u''' Hydrogen, Silicon
* Get a separate beaker
* Add '''5u''' Sodium, Chlorine, Water
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Heat to 480°K. Adding the following chemicals will cool the mix below the explosion threshold.
* Add '''10u''' Potassium, Nitrogen
* Add '''30u''' Oxygen
* Add '''30u''' Sulfur
* Remove '''50u''', then remove an additional '''30u'''
* Add '''10u''' Silver, Stable Plasma
* Heat to >400°K, but below 474°K
* Add '''30u''' of the resulting [[Guide to chemistry#Teslium|Teslium]] to the main beaker
* Get a separate beaker
* Add '''10u''' Lithium, Mercury, Sugar
* Heat to >674°K
* Add '''30u''' of the resulting [[Guide to chemistry#Neurotoxin|Neurotoxin]] to the main beaker

=== <s>[[Guide to chemistry#Skewium|Skewium]] </s>===
Skewium no longer exists.
* Remove '''50u'''
* Add '''40u''' of Plasma (grind some raw plasma)
* Add '''20u''' of Sulphuric Acid

== [[Guide to chemistry#Carbon Dioxide|Carbon Dioxide]] ==

* Add '''30u''' Carbon
* Add '''60u''' Oxygen
* Heat to >777°K

== Herbicides ==

=== [[Guide to chemistry#Weed Killer|Weed Killer]] ===

* Add '''60u''' Hydrogen
* Add '''20u''' Nitrogen
* Add '''30u''' Hydrogen
* Add '''10u''' Nitrogen
* Remove '''10u'''
* Add '''20u''' Toxin (found in hacked Nanomed Plus)

=== [[Guide to chemistry#Pest Killer|Pest Killer]] ===

* Add '''80u''' Ethanol
* Add '''20u''' Toxin (found in hacked Nanomed Plus)

=== [[Guide to chemistry#Plant-B-Gone|Plant-B-Gone]] ===

* Add '''80u''' Water
* Add '''20u''' Toxin (found in hacked Nanomed Plus)

= Manual Recipes for Utility =
{{anchor|Utility}}

== [[Guide_to_construction#Plastic|Plastic sheets]] ==
The main use for plastic sheets is making large water bottles - these are functionally identical to large beakers.

* Add 30 units each of Welding Fuel, Carbon and Hydrogen to a large beaker.
* This combines into [[Oil]]. Discard 10 units.
* Separate 30 units of [[Oil]], then heat the bottle to 1000°K until it turns to Ash.
* To the remaining [[Oil]], add 20 units [[Sulphuric Acid]].
* Add the Ash to the [[Oil]]/[[Sulphuric Acid]] mix.
* Now, heat the resulting mix to roughly 375°K.
* You now have enough [[Guide_to_construction#Plastic|Plastic]] sheets to make a lot of large bottles!

== Metal foam grenade ==
While not as elegant as smart foam, this one is great for dealing with AI turrets and containing [[Critter]] outbreaks.

* Make enough [[Fluorosulfuric Acid]] and [[Foaming Agent]] that you end up with 30u each.
* Fill beaker A with 90 units of Iron and insert into the grenade casing.
* Put 30u of [[Fluorosulfuric Acid]] and [[Foaming Agent]] each into beaker B and finish up the grenade.

== [[Guide to chemistry#Firefighting Foam|Firefighting Foam]] ==

* Add '''20u''' Carbon, Fluorine
* Add '''10u''' Sulphuric Acid
* Remove '''20u'''
* Add '''10u''' Iron, Oxygen, Hydrogen
* Add '''30u''' Carbon
* Cool to 200°K

= Manual Recipes for Virology =
{{anchor|Virology}}

== [[Guide to chemistry#Virus Food|Virus Food]] ==

* Add '''30u''' Water, Milk (found by using a Biogenerator. Or milk a goat or a cow. Or from [[File:Milk.png]] Space Milk cartons, 50 units in each. 5 are found in kitchen freezer. Ordered food crate has one.)

=== [[Guide to chemistry#Virus Rations|Virus Rations]] ===

* Remove '''30u''', then remove an additional '''15u'''
* Add '''15u''' Sugar, Lithium, Water

=== [[Guide to chemistry#Mutagenic Agar|Mutagenic Agar]] ===

* Remove '''30u''', then remove an additional '''15u'''
* Add '''15u''' Chlorine, Phosphorus, Radium

==== [[Guide to chemistry#Sucrose Agar|Sucrose Agar]] ====

* Remove '''30u''', then remove an additional '''10u'''
* Add '''50u''' of Sugar or Saline-Glucose Solution

=== [[Guide to chemistry#Virus Plasma|Virus Plasma]] ===

* Remove '''30u''', then remove an additional '''10u'''
* Add '''50u''' of Plasma (found when grinding plasma ore)

==== [[Guide to chemistry#Weakened Virus Plasma|Weakened Virus Plasma]] ====

* Remove '''30u''', then remove an additional '''15u'''
* Add '''15u''' Sugar, Lithium, Water

==== [[Guide to chemistry#Unstable Uranium Gel|Unstable Uranium Gel]] ====

* Remove '''50u''', then remove an additional '''25u'''
* Add '''50u''', then an additional '''25u''' of Uranium (found when grinding uranium ore)

=== [[Guide to chemistry#Decaying Uranium Gel|Decaying Uranium Gel]] ===

* Remove '''30u''', then remove an additional '''10u'''
* Add '''50u''' of Uranium (found when grinding uranium ore)

== [[Guide to chemistry#Stable Uranium Gel|Stable Uranium Gel]] ==

* Add '''30u''', then an additional '''10u''' of Silver, Uranium (found when grinding uranium ore)
* Add '''4u''' of Plasma (found when grinding plasma ore) using a dropper set to use 1u amounts

= 'Fun' =

== Carpet smoke grenade ==
Want to spruce up the station? Start throwing these grenades everywhere. Obscures vision for a while.

* Make 30 units of [[Space Drugs]] and extract 30u of Blood from someone.
* Beaker A: 30u [[Space Drugs]], 30u Potassium.
* Beaker B: 30u Phosphorus, 30u Blood, 30u Sugar.

== [[Guide to chemistry#Colorful Reagent|Colorful Reagent]] ==
Grab a spray bottle to mix.

'''Skip this part if you already have 60u Cryoxadone ready'''
* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''15u''' Oxygen, Welding Fuel
* Remove '''15u''' from the beaker
* Add '''10u''' Chlorine, Phosphorus, Radium
* Add '''30u''' Stable Plasma
* Remove '''30u''' from the beaker
--> '''60u''' Cryoxadone
* (Add '''60u''' Cryoxadone)
* Add '''20u''' Lithium, Mercury, Sugar
* Remove '''20u'''
--> '''50u''' Cryoxadone and Space Drugs
* Add '''10u''' Lemon+Lime+Orange Juice (Triple Citrus)
* Add '''50u''' Radium, Stable Plasma

== [[Guide to chemistry#Corgium|Corgium]] ==

'''Skip this part if you already have 15u Cryoxadone ready'''
* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''15u''' Oxygen, Welding Fuel
* Remove '''15u'''
* Add '''5u''' Chlorine, Phosphorus, Radium
* Add '''15u''' Stable Plasma
* Remove '''30u'''
-> '''15u''' Cryoxadone
* (Add '''15u''' Cryoxadone)
* Go to the bar, ask the bartender for some [[Guide to food and drinks#Triple Citrus|Triple Citrus]]. If the bartender isn't there, climb onto the table, and access the non-alcoholic drink dispenser. (It isn't ID locked!) Add '''5u''' Lemon Juice, Lime Juice, Orange Juice
* Add '''5u''' Lithium, Mercury, Sugar
* Add '''15u''' Stable Plasma, Radium
* Remove '''50u''', then remove an additional '''10u'''
* Get a separate beaker (a normal beaker which can hold 50u will do just fine, albeit by this point you should probably have bluespace beakers or large water bottles)
* Add '''5u''' Chlorine, Phosphorus, Raddium
* Remove '''10u'''
* Add '''5u''' Holy Water (get the chaplain to bless it for you)
* Add '''5u''' Omnizine (You can get omnizine through grinding heated donk pockets, or through nicely asking the botanist, since omnizine is naturally found in Ambrosia Deus. If you're lucky, the CMO starts the shift with his/her hypospray loaded with omnizine.)
* Add '''15u''' of the resulting [[Guide to chemistry#Strange Reagent|Strange Reagent]] to the original beaker
* Add '''15u''' of Nutriment (Just vend some food from the Getmore Chocolate Corp and grind it up)
* Get a separate beaker (normal beaker is aforementioned fine)
* Add '''15u''' of Blood
* Heat the beaker containing only blood to about 1000°K

'''How to maxcap the station with absolute adorableness'''

* Acquire a dropper, and adjust it to transfer in 1u amounts
* Go to your target destination
* Draw 1u of the heated blood (Solutions do not lose heat over time! The only way to change the temperature of a solution is by using a heater or a freezer.)
* Inject 1u of the heated blood into your other beaker. Every time 1u of blood is injected into the other beaker, an independent reaction occurs, which produces a corgi.
* Repeat. All your hard work will eventually lead to 15 corgis being let loose onto the station.

== [[Guide to chemistry#Life|Life]] ==

* Add '''5u''' Chlorine, Phosphorus, Radium
* Add '''15u''' Holy Water (Ask the chaplain to bless it for you, or ask the botanist for holymelons)
* Add '''15u''' Omnizine (Found in heated Donk Pockets, Ambrosia Deus, and in the CMO's hypospray)
* Remove '''15u'''
* Get a separate beaker for [[#Synthflesh|Synthflesh]] (this will need buffers, or it will fail)
* Add '''5u''' Welding Fuel, Carbon, Hydrogen
* Remove '''10u'''
* Add '''5u''' Chlorine, Water
* Remove '''5u'''
* Add '''10u''' Nitrogen, Oxygen
* Add '''30u''' Carbon, Blood (or 5u Blood + 25u Unstable Mutagen)
* Add '''30u''' of the resulting Synthflesh to the main beaker
* Add '''30u''' Blood (for hostile life) or '''30u''' Sugar (for friendly life)
Heat beaker to at least 375K.

== [[Guide to chemistry#Quantum Hair Dye|Quantum Hair Dye]] ==

'''Skip this part if you already have 15u Cryoxadone ready'''
* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''15u''' Oxygen, Welding Fuel
* Remove '''15u'''
* Add '''5u''' Chlorine, Phosphorus, Radium
* Add '''15u''' Stable Plasma
* Remove '''30u'''
-> '''15u''' Cryoxadone
* (Add '''15u''' Cryoxadone)
* Go to the bar, ask the bartender for some [[Guide to food and drinks#Triple Citrus|Triple Citrus]]. If the bartender isn't there, climb onto the table, and access the non-alcoholic drink dispenser. (It isn't ID locked!) Add '''5u''' Lemon Juice, Lime Juice, Orange Juice
* Add '''5u''' Lithium, Mercury, Sugar
* Add '''15u''' Stable Plasma, Radium
* Remove '''30u''', then remove an additional '''15u'''
* Add '''10u''' Lithium, Mercury, Sugar
* Add '''30u''' Radium

== [[Guide to chemistry#Barber's Aid|Barber's Aid]] ==

* Add '''5u''' Lithium, Mercury, Sugar
* Add '''15u''' Blood
* Add '''10u''' Lithium, Mercury, Sugar
* Add '''30u''' Radium

=== [[Guide to chemistry#Concentrated Barber's Aid|Concentrated Barber's Aid]] ===

* Remove '''30u''' and then remove an additional '''15u'''
* Add '''15u''' Chlorine, Phosphorus, Radium

== [[Guide to chemistry#Condensed Capsaicin|Condensed Capsaicin]] ==

* Add '''15u''' of Capsaicin (bug botany for chilis)
* Add '''75u''' of Ethanol

== [[Guide to chemistry#Spray Tan|Spray Tan]] ==

* Add '''15u''' Welding Fuel, Carbon, Hydrogen
* Add '''15u''' Orange Juice (found in the bartender's non-alcoholic drink dispenser)

== [[Guide to chemistry#Nitrous Oxide|Nitrous Oxide]] ==

* Add '''30u''', and then an additional '''15u''' of Hydrogen
* Add '''15u''' of Nitrogen
* Remove '''5u'''
* Add '''20u''' Nitrogen
* Add '''40u''' Oxygen
* Heat to 525°K

Note: Nitrous Oxide explodes at 575°K

== [[Guide to chemistry#Laughter|Laughter]] ==

A suitable substitute gift for the clown. Unlike Space Lube, will most likely not get you lynched.

* Add '''50u''' Sugar, Banana Juice (can only be acquired through juicing raw bananas, which can be found in botany)

== [[Guide to chemistry#Synthmeat|Synthmeat]] ==

'''Skip this part if you already have 15u Cryoxadone ready'''
* Add '''5u''' Carbon, Hydrogen, Welding Fuel
* Add '''15u''' Oxygen, Welding Fuel
* Remove '''15u'''
* Add '''5u''' Chlorine, Phosphorus, Radium
* Add '''15u''' Stable Plasma
* Remove '''30u'''
-> '''15u''' Cryoxadone
* (Add '''15u''' Cryoxadone)
* Add '''75u''' Blood

== [[Guide to chemistry#Carpet|Carpet]] ==

* Add '''15u''' Lithium, Mercury, Sugar
* Add '''45u''' Blood

[[Category:Guides]][[Category:Chemistry]]

Station Goals

2026-03-02T18:00:55Z

Krytoi: Перевод ДНК хранилища

{{Требуется перевод}}
Station Goals are special long-term objectives for the crew to pursue, which result in very special and powerful machines.

The Station Goal for each round is random, and communicated in the Blue Alert report at every communications console. In the event the round mode is Extended, all three goals are available to be built.

=Goals=
<tabs>
<tab name="Bluespace Artillery">
==Bluespace Artillery==

[[File:BSA_cinematic.png]]

To complete this station goal you'll need to build a functional Bluespace Artillery!

[[File:bsasetup.png|thumb|A correctly configured Bluespace Artillery for a west-facing cannon.]]

=== Steps to Complete ===

# To start with, you'll need to order the circuit boards from cargo; the crate costs 15000 credits and is only unlocked if this is the station objective. It can be ordered multiple times.
# Next you need to set up three machine frames '''horizontally''', and another machine frame below the middle, forming a T. When positioning it remember the cannon will destroy everything in front of it, so point it at space and not towards the station. The cannon will also require a 10 tile wide horizontal space to complete. This doesn't include space tiles, so make sure to put down floor tiles if need be.
# Start [[Machines|building the machines]]. The Artillery Generator is the back part, the Artilery Bore is the front, and the Artillery Fusor goes in the middle. The machine frame below will be the console, and requires no parts.
# Collect the materials to make the machines. The Generator requires 5 [[Quadratic capacitor|Quadratic Capacitor]]s, the Bore requires 5 [[Femto-manipulator|Femto-Manipulator]]s, and the Fusor requires 20 [[Bluespace Crystal]]s.
# After you complete all the parts, use a multitool to link both ends of the artillery to the fusor in the middle. Then use the console to finalize the construction; if the full sprite appears, you now have a functional bluespace artillery.
# In order to power the BSA, it will need to be in its own room as defined by the station's blueprints. That means it needs to be in an airtight room that doesn't already have a name. You will also need to wire the console to the APC once you've constructed one.

=== Benefits ===

Building the Bluespace Artillery will let you fire it at will! To do so it'll need a lot of power, drawn from the room's APC. The target is chosen with the console, which can aim at any GPS signal. Firing the Artillery will then obliterate the target and anything around it. The BSA is not limited by Z-Levels, and can be used towards lavaland or even CentCom, if you manage to get a GPS in there.

Remember to not stay in front of the artillery when it fires, unless you enjoy being vaporized!

A word of caution to those foolish enough to build the Bluespace Artillery in an unsecured area, it can be emagged, causing the next person to fire it to be the one targeted by the blast instead.
</tab>
<tab name="ДНК Хранилище">
==ДНК Хранилище==

[[File:Dna_vault_cinematic.gif]]

Что бы выполнить эту цель станции вам понадобится построить и заполнить ДНК хранилище!

=== Шаги для выполнения ===

# Что бы начать, вам нужно заказать печатные платы в карго; сундук стоит 12000 кредитов и может быть заказан только лишь с соответствующей целью. Может быть заказан многоразово
# Постройте machine frame в там где хотите сделать хранилище. Оно будет расположено к верхней части как показано сверху. В идеале должно быть построено в публичном месте что бы каждый мог заполнять хранилище ДНК. Вставьте плату, 5 super capacitors и 5 pico-manipulators (QUADRATIC CAPACITORS И FEMTO MANIPULATORS НЕ БУДУТ РАБОТАТЬ) и используйте отвёртку что бы его построить.
# Закажите ящик с ДНК сэмплерами в карго. Ящик будет стоить 3000 кредитов и иметь 5 сэмплеров ДНК, которые многоразовые.
# Используйте сэмплеры для сбора ДНК!
Вам нужно:
#* 15-20 ДНК животных, полученных сканированием симплмобов таких как [[Иан]] или [[слаймы]]. Животные должны быть разных видов. '''Ксенобиология будет очень полезна для этого'''
#* 20-25 ДНК растений, полученных путём сканирования созревших растений. Растения также должны быть разных видов; вам придётся [[Guide_to_hydroponics|мутировать]] их для достижения цели.
#* 75% ДНК от раундстартовой популяции игроков станции. ДНК необязательно должна быть игроков, можно также использовать ДНК [[Guide_to_genetics|мартышек]]
# Вставить образцы ДНК в хранилище используя сэмплер на нём.
# Когда все задачи выполнены, ДНК хранилище становится активным, цель выполняется, а вы можете взять себе генетические улучшения!

=== Плюсы ===

Когда ДНК хранилище построено, каждый человек получает выбор одного из '''двух''' генов. Не требует ничего для вживления генов и может быть использовано кем угодно.

* '''Toxin Adaptation:''' Делает пользователя неуязвимым к токсичным газам, и даёт абсолютный иммунитет от вирусов
* '''Lung Enhancement:''' Пользователю больше не нужно дышать. Имеет побочный эффект который будет наносить урон травмами вместо удушья в критическом состоянии
* '''Thermal Regulation:''' Делает пользователя огнеупорным и снижает весь получаемый урон от ожогов в два раза
* '''Neural Repathing:''' Срезает время оглушения в два раза
* '''Bone Reinforcement:''' Даёт 30% брони от всех видов урона
* '''Leg Muscle Stimulus:'''Двигайся быстрее, меньше замедления от одежды которая тебя замедляет
* '''Arm Muscle Stimulus:''' Действуй быстрее, меньше интервал между действиями. <s>Выбор повергеймера</s>
</tab>
<tab name="Station Shield">
==Station Shield==

[[File:Meteor_shield.png]]

[[File:Meteor Point-Defense Satellites.png|thumb|Unactivated satellites]]

To complete this station goal you'll need to build a ring of meteor defense satellites!

=== Steps to Complete ===

# To begin, you will probably want to grab a hardsuit from either EVA storage, or engineering department
# As with most other station goals, the supplies you will need are going to need can be ordered from cargo.
#* The satellite crate, which comes with 3 satellites can be ordered for 3K points
#* The satellite board crate, which comes with the required computer board can be ordered for 5K points.
# I would recommend starting out with the satellite crate as it is both cheaper, and requires some moving around.
# Inside the satellite crate you will find 3 meteor point defense satellites which can only be activated in space, and will act as the shield to protect the station.
# Take the satellites into space, and activate them around the station. Some recommended locations are:
#* Near the AI sat, to protect the AI
#* Near to armory, to protect from being open to space
#* Near SM, to make sure it doesn't delaminate
# Feel free to order more than one sat crate. You can have many satellites online at a time.
# Next, you will need to get the board crate which, contains the board
# In a secure space, such as your office or the brig, construct a machine frame, wrench it down, add the board, and screwdriver it.
# ( It is worth noting that this is definitely the easiest station goal to get, you require nothing except cargo points. )
# Finally, the console should be online, and you will be able to use your newfound point-defense satellites!

=== Benefits ===

* Fairly straightforward, you don't have to worry about meteors!
* The satellites destroy meteors with pinpoint precision at a high range, no matter the speed or size!
* They also generally reduce the chance of a meteor shower...
* ...unless they're [[emag|emagged]], which will instead significantly increase the chance of meteors!
</tab>
</tabs>

Снаряжение Синдиката

2026-02-26T20:38:17Z

Krytoi: Переведено вступление аплинка ядерных оперативников, частично переведён набор "индукции", переведена часть опасных оружий оперативников (но не ихние особые боеприпасы)

{{Требуется перевод}}

=Предметы Синдиката=
Это, надеюсь, полный список всех предметов, которые [[Traitor|Предатели]] и [[Nuclear Operative|Ядерные оперативники]] могут получить через свой '''аплинк''', заплатив '''Телекристаллы'''. 
Первый раздел содержит все предметы, которые может купить предатель, причем предметы, доступные ядерным оперативникам, обозначены зеленым "Да" в соответствующей колонке. 
Второй раздел содержит предметы, предназначенные исключительно для ядерных оперативников.

==Твой Аплинк==

{|
|[[File:traitor.png]]
|У предателей по умолчанию есть ПДА [[file:normalpda.gif]], служащий в качестве аплинка. В настройках игры это можно изменить на вашу гарнитуру[[file:headset.png]], ручку[[file:pen.png]] или предустановленный [[#Uplink_Implant|имплант аплинка]] [[file:Implant_Case.png]](-4 стартовых ТК).
Страница магазина скрыта от посторонних глаз, и чтобы открыть её, вам нужно будет либо ввести специальный код, который вы получите в качестве собственного рингтона вашего ПДА, либо выбрать специальную частоту на вашей специальной гарнитуре, либо нажать на специальную ручку, в зависимости от того, что вы выберете в качестве своего предпочтения. Интерфейс магазина разделен на категории. Предатели начинают с 20 телекристаллами, всегда.
|}

Некоторые предметы очень дороги и требуют более высокого уровня репутации. Уровень репутации и телекристаллы можно получить, выполняя задания. Как? В категории "objectives" вы можете выбрать задачу, перетащив ее в пустой слот, которую вам нужно будет выполнить, а затем сдать, чтобы получить ТК и/или повысить уровень репутации. Все агенты синдиката знают '''кодовые слова''' , по которым узнают друг друга на станции, но помните, что '''предатели не обязаны сотрудничать.'''

Помните, что существуют '''Скидки!''':
До трех предметов, уникальных для каждого аплинка, можно купить *один раз* каждый по случайной цене со скидкой. Более дешевые предметы уцениваются чаще, и в среднем скидки составляют около 50%, но время от времени вы можете сорвать джекпот и получить револьвер со скидкой 80%.

===Комплекты===
{| class="wikitable sortable"
!<abbr title="Can Nuclear operatives order this item?">Опер?</abbr>
!Предмет
! class="unsortable" |Иконка
!Цена
!Репутация
! class="unsortable" |Описание
! class="unsortable" |Инфо
|-
|Да
| id="Box_of_Throwing_Weapons" |Сырые телекристаллы
|
|1
|0
|Вы можете напрямую достать телекристалы из своего аплинка, чтобы внести на другой аплинк. Полезно для обмена с другими предателями, или же добавления в имплант аплинка.
|
|-
|Нет
| id="Energy_Sword" |Syndie-Kit Tactical
|[[file:Syndibox.png|link=https://tgstation13.org/wiki/File:Syndibox.png]]
|20
|300
|Набор снаряжения Синдиката общей стоимостью больше 25 телекристалов, может содержать предметы, отсутствующие в стандартном аплинке. Все наборы базируются на определенной тематике. Вы можете купить лишь один набор, и вы не сможете выбрать какой набор получить. многие наборы содержат ключи шифрования Синдиката, для координации с другими агентами или прослушивания системы коммуникации станции. Наборы отличаются по своей полезности, некоторые менее желанные, чем другие.
{| class="mw-collapsible mw-collapsed" style="width:100%"
! class="unsortable" |Название
! class="unsortable" |Contents
!Notes
!Weight
|-
| id="9mm_Handgun_Magazine" |Recon
|X-ray goggles, bluespace launchpad, binoculars, syndicate spacesuit, EMP flashlight, 2 frag grenades,
syndicate encryption key.
|Единственный способ получить рентгеновское зрение, даёт невероятное преимущество.
|2
|-
| id="9mm_Incendiary_Handgun_Magazine" |Spy
|Agent ID, partial chameleon kit, chameleon no-slips, camera bug, AI detector, mulligan, switchblade, syndiecigs,
EMP flashlight, chameleon projector, storage implant, syndicate encryption key
|Спроектирован для скрытности и разных хитростей.
|3
|-
| id="9mm_Armor_Piercing_Magazine" |Stealth
|Energy bow, sleepy pen, radioactive microlaser, chameleon projector, syndie soap, thermal goggles, EMP flashlight,
radio jammer, syndicate encryption key
|Вариативный и хорошо подходящий для убийств.
|2
|-
| id="9mm_Hollow_Point_Magazine" |Gun
|.357 Revolver, 2 speedloaders, chameleon holster, airlock override card, C4, and an outfit and clown mask.
|Идеален в своей простоте. Пристрели экипаж.
|2
|-
|Screwed
|Syndicate bomb, minibomb, power sink, syndicate spacesuit, syndicate encryption key
|Будет плохо или тебе, или станции.
|2
|-
|Murder
|Energy sword, thermal goggles, airlock override card, chameleon no-slips, minibomb, syndicate encryption key
|Любишь причинять людям боль?
|2
|-
|Implants
|Freedom implant, uplink implant, EMP implant, explosive implant, storage implant.
|В импланте аплинка уже есть 10 телекристалов. Осторожнее с имплантом подрыва.
|1
|-
|Hacker
|Hacked AI law upload module, cryptographic sequencer, airlock override card, binary encryption key, hacked Toy AI that
uploads ion laws, AI detector, syndicate toolbox, camera bug, thermal goggles, Agent ID.
|Заставь ИИ или киборгов делать грязную работу за тебя.
|3
|-
|Sabotage
|3 C4, 2 X4, camera bug, power sink, DETOmatix cartridge, syndicate toolbox, pizza bomb, EMP kit.
|Полный хаос и разруха. Кроме того, сумка со взрывчаткой очень вместительная и не замедляет, если вы не прочь носить синдикатовское снаряжение у всех на виду.
|3
|-
|Sniper
|Sniper rifle, penetrator magazine, thermal goggles, and an outfit and clown mask.
|Снайперская винтовка обычно доступна только ядерным оперативникам, так что дополнительные патроны купить не выйдет.
|1
|-
|Meta Ops
|Syndicate modsuit, bulldog shotgun, two shotgun magazines, explosive implant, 2 C4, airlock override card,
cryptographic sequencer.
|Вы будете целью номер один для станции, так как теперь у вас статус молодого ядерного оперативника. Имейте в виду, что дробовик из набора может использоваться не только агентами, не дайте застрелить себя вашим же оружием.
|1
|}
|Подходит для тех, кто не знает, какое снаряжение им нужно, но все же хочет иметь солидный набор мощного снаряжения синдиката.
Можно купить только один.
|-
|Нет
| id="Double-bladed_Energy_sword" |Syndie-Kit Special
|[[file:Syndibox.png|link=https://tgstation13.org/wiki/File:Syndibox.png]]
|20
|300
|Набор снаряжения Синдиката общей стоимостью больше 25 телекристалов, может содержать предметы, отсутствующие в стандартном аплинке. Все наборы базируются на определенной тематике. Вы можете купить лишь один набор, и вы не сможете выбрать какой набор получить. Это специализированные наборы, заполненные необычными вещами, некоторые из которых достать другим путём невозможно!
{| class="mw-collapsible mw-collapsed" style="width:100%"
! class="unsortable" |Название
! class="unsortable" |Contents
!Notes
!
|-
| id="9mm_Handgun_Magazine" |James Bond
|Makarov pistol, suppressor, two magazines, agent ID, chameleon jumpsuit, stimulant injector, damp rag, freedom implant,
EMP flashlight, X4, bottle of cyanide pills, deck of syndicate cards.
|Взболтать, но не смешивать. Станьте классическим тайным агентом. Или отравите еду и пристрелите тех, кто пытается вам помешать.
|2
|-
| id="9mm_Incendiary_Handgun_Magazine" |Ninja
|Katana (powerful slashing weapon that deals a whopping 40 brute and has a 50% block chance), stimulant injector,
six throwing stars, chameleon belt, chameleon projector, agent ID, airlock override card, smoke spellbook, jump boots
|Катана невероятно смертоносна и справится практически с кем угодно в ближнем бою. Используйте сочетание оружия и скрытного снаряжения, чтобы убить цель и тут же исчезнуть.
|1
|-
| id="9mm_Armor_Piercing_Magazine" |Dark Lord
|Dual energy sword, telekinesis mutator, dark robes, agent ID, no-slip shoes, lightning bolt spellbook, summon item spellbook
|УЗРИ СИЛУ ТЁМНОЙ СТОРОНЫ. Стань настоящим лордом ситхов. Не забудьте применить заклинание возврата к мечу, чтобы вас не зарезали им же.
|1
|-
| id="9mm_Hollow_Point_Magazine" |White Whale,
Holy Grail
|Harpoon gun and quiver, spaceproof carp outfit, carp grenade, dehydrated carp.
|Гарпун втыкается в людей и невероятно эффективен для убийств. Захватите станцию для космических карпов.
|2
|-
|Mad Scientist
|Labcoat, boots, megaphone, two random cluster grenades, bioterror foam grenade, four signallers, syndicate toolbox,
energy dagger, portal gun, decloner gun.
|Несколько необычных вещей, несущих хаос. Кластерные гранаты со случайным содержимым варьируются от бесполезных до невероятно разрушительных.
|2
|-
|Bees
|Bee costume and gear, two bee grenades, beesease disease bottle, bee sword.
|Пчелиный меч наносит не слишком много урона, но бьет очень быстро и вводит токсины в цель. Пчелиная граната выпускает рой смертоносных пчёл, а кейс с пчёлами заражает людей, заставляя тех выкашливать еще больше пчёл. Пчёлы!
|1
|-
|Mr Freeze
|Cold outfit, chameleon mask, four gluon grenades, geladikinesis injector, cryokinesis injector, freezing gun, cryo gun,
blue energy sword.
|Превратите любую станцию в Icebox. Станьте бичом ящеров. Полностью нивелируется ассистентом пьющим кофе.
|2
|-
|2006
|All items come in an ancient toolbox. Cryptographic sequencer, airlock override card, sleepypen, bottle of cyanide pills,
chameleon projector, 357 revolver, freedom implant, and a spare telecrystal.
|Старая школа. Покажите собакам Нанотрейзен как это делалось в былые дни. Плачьте о том что airlock override card и cryptographic sequencer когда то были одной вещью.
|1
|}
|Подходит для тех, кто не знает, какое снаряжение им нужно, но все же хочет иметь солидный набор мощного снаряжения синдиката.
Можно купить только один.
|-
|Нет
|Syndicate Surplus Crate
|[[File:GrayCrate.png]]
|20
|0
|Содержит случайные предметы на сумму в 30 телекристалов, не зависящие от уровня репутации. Изменить одержимое у вас не получится, но вы получите больше, чем заплатили . Хорошая цена, хотя в конечном итоге вы можете получить кучу мусора или вещей, которые вам некуда применить. Покупка единоразовая. Никаких возвратов!
|Подходит для азартных людей, хотя, вероятно, вам лучше потратить свои телекристалы на что-нибудь другое.
|-
|Нет
|United Surplus Crate
|[[File:Syndicrate.png]]
|20
|300
|Содержит предметы на колоссальную сумму в 80 телекристалов, с одной оговоркой - ящик заперт, любые попытки взлома приведут к детонации вместе со всем содержимым. единственный способ открыть- использовать United Surplus Crate Key, но помните, агент может купить лишь один из этих предметов. Придётся договариваться или забирать силой у другого агента один из этих предметов.
|Хорош для кооперативных предателей, еще лучше для коварных. Очень ценный.
|-
|No
|United Surplus Crate Key
|[[file:Syndicrate_key.png]]
|20
|300
|Открывает United Surplus Crate, позволяя получить доступ к хранящимся в нем сокровищам. Нельзя купить вместе с United Surplus Crate. Придётся договариваться или забирать силой у другого агента один из этих предметов.
|Хорош для кооперативных предателей, еще лучше для коварных. Очень ценный.
|}

===Conspicuous and Dangerous Weapons===
'''Note:''' the ammo category has been rolled into the weapon's tables for efficiency sake.
{|class="wikitable sortable"
!<abbr title="Can Nuclear operatives order this item?">Ops?</abbr>
!Предмет
!class="unsortable"|Иконка
!Цена
!Репутация
!class="unsortable"|Описание
!class="unsortable"|Инфо
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Box_of_Throwing_Weapons"|Box of Throwing Weapons
|[[file:syndie_box.png]]
|style="text-align: center;"|3
|100
|Набор содержит 5 сюрикенов и две укреплённые болы. Сюрикены наносят много брут урона и втыкаются в тело, продолжая наносить урон и вызывая кровопотерю, пока не будут вытащены. Укреплённые болы [[Status_Effects#Knockdown|сбивают с ног]] на 3.5 second и будут замедлять, если их не снять. Они снимаются дольше чем стандартная [[Makeshift_weapons#Bola|бола]].
|Не лучшее основное оружие, но этот набор может отлично дополнить ваш арсенал. Он особенно полезен при побеге.
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Energy_Sword"|Energy Sword
|[[file:sword.gif]]
|style="text-align: center;"|8
|200
|Это оружие ближнего боя, которое наносит большой (30) брут урон. У него также есть высокий шанс сбить кого-то с ног или ошеломить. Имеет два состояния: включен и выключен. Когда он выключен, его можно положить в карман, но в таком виде это ужасное оружие. Имейте в виду, звук включения громкий и слышен довольно далеко. При включении у вас есть приличный шанс отразить снаряды. Для достижения наилучших результатов сочетайте это со снаряжением способным оглушить, замедлить или иным образом вывести из строя; помните, что если его выбьют из ваших рук, существует большой шанс быть зарезанным своим собственным оружием.
|Очень хорошо сочетается с мини энергоарбалетом.
Если использовать на нем мультитул, то меч начнет светиться всеми цветами радуги.
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Double-bladed_Energy_sword"|Double-bladed Energy Sword
|[[file:Desword.gif]]
|style="text-align: center;"|16
|300
|Двойной энергетический меч — чрезвычайно мощное оружие, способное отправить небронированную жертву в критическое состояние всего за 3 удара (и, вероятно, оглушить ее, расчленить или лишить сознания задолго до этого). Как и одноручный [[#Energy_Sword|Энергомеч]], для правильного использования его необходимо включить, а в выключенном состоянии его можно хранить в кармане. Основная причина, почему это оружие настолько мощное по сравнению со своим предшественником, заключается в том, что оно гарантированно отразит все энергетические снаряды, посланные в него, обратно в стрелявшего. Это делает неробастных офицеров совершенно бесполезными на дистанции и позволяет легко убить их, если в них отразится пара выстрелов. Также у него есть шанс отразить пули, но не стоит целиком полагаться на это. Это остановит некоторые, но не все атаки ближнего боя, поэтому старайтесь избегать поединков против людей с электропалками. Выстрелы из температурного пистолета проходят сквозь защиту.
|25+ players only.
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Gloves_of_the_Northstar"|Gloves of the North Star
|[[file:North_star.png]]
|style="text-align: center;"|8
|200
|Пара перчаток, которые значительно сокращают время между ударами кулаками, позволяя вам забивать людей до смерти шквалом ударов. Вы даже можете установить боевой клич из любимого японского аниме! Не работает на удары халков.
|AAAATATATATATA!!
|-
|style="text-align:center; background-color:#FF4136;"|Нет
|id="Holoparasite"|Holoparasite injector kit
|[[file:Syndibox.png]]
|style="text-align: center;"|18
|300
|Содержит инъектор с [[Holoparasite|голопаразитом]]. При инъекции он попытается вызвать [[Ghost|призрак]] игрока чтобы взять на себя роль духоподобной сущности, живущей в вашем теле и способной использовать различные силы, чтобы помочь вам, в зависимости от ее типа. Если ни один призрак не был доступен, то можно оформить возврат, чтобы получить назад потраченные ТК. Голопаразиты могут входить и выходить из тела пользователя по своему желанию, а также общаться с хозяином посредством бесшумной телепатии, что позволяет им действовать скрытно. Разные типы голопаразитов обладают разными способностями, и некоторые из них могут быть невероятно мощными, но их использование требует определенных навыков со стороны вашего союзника. Кроме того, любой урон, получаемый голопаразитом, возвращается обратно его владельцу, так что не ждите, что ваше боевое привидение впитает пули за вас! Когда голопаразит или его хозяин умирает, труп пользователя рассыпается в прах, не позволяя реанимировать его.
|25+ players only
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Power_fist"|Power fist
|[[file:powerfist.png]]
|style="text-align: center;"|6
|200
|Металлический кулак, работающий на газе. Он отправит в полет любого, кого вы ударите, пока хватает газа. Для работы требует газ, поступающий из баллона (не входит в комплект). Чтобы установить баллон, просто нажмите на силовой кулак, держа его в руке. Клапан давления можно отрегулировать с помощью гаечного ключа до положения 1, 2 и 3. Первый вариант наносит 20 урона и отбрасывает людей на 1 тайл вперед. Установка второго и третьего удвоит и утроит эти значения соответственно, то есть 40/60 урона и 2/3 дальность отбрасывания.
Стандартного наполненного баллона с воздухом хватает на 4 полных удара во втором режиме и 3 на третьем. Чтобы снять пустой баллон, используйте отвертку на силовом кулаке.
|Носиться не как перчатки, а просто держится в руке. Газ в резервуаре выбрасывается в окружающую среду после каждого удара.
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Makarov_Pistol"|Makarov Pistol
|[[file:Stetchkin.png]]
|style="text-align: center;"|7
|100
|Маленький пистолет, помещается в карман. Имеет магазин на 8 патронов и является полуавтоматическим, то есть при выстреле из него выбрасываются гильзы, что затрудняет очистку улик. Стандартные боеприпасы наносят 30 грубых повреждений небронированной цели за выстрел, но опустошение магазина в одну цель обычно убивает или наносит критический удар всем, кроме наиболее хорошо подготовленных и/или бронированных противников. Может быть оснащен глушителем, что делает его намного тише, однако при этом размер увеличивается до нормального, и он больше не поместится в кармане. Стреляет 9мм патронами.
{|class="mw-collapsible mw-collapsed" style="width:100%"
! class="unsortable" |icon
! class="unsortable" |Название
! class="unsortable" |ammo types
!cost
!rep
|-
|[[file:10mmMag.png]]
| id="9mm_Handgun_Magazine" |9mm Handgun Magazine
|30 урона
| style="text-align: center;" |1
|100
|-
|[[file:10mmmagfire.png]]
| id="9mm_Incendiary_Handgun_Magazine" |9mm Incendiary Handgun Magazine
|15 урона, добавляет 2 стака горения
| style="text-align: center;" |2
|300
|-
|[[file:10mmmagAP.png]]
| id="9mm_Armor_Piercing_Magazine" |9mm Armor Piercing Magazine
|27 урона, 40 бронепробития
| style="text-align: center;" |2
|300
|-
|[[file:10mmmaghollow.png]]
| id="9mm_Hollow_Point_Magazine" |9mm Hollow Point Magazine
|40 урона, -50 бронепробития
| style="text-align: center;" |3
|300
|}
|Ранее назывался «Стечкин». Иногда можно найти за пределами станции.
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Revolver"|.357 Revolver
|[[file:Revolver.png]]
|style="text-align: center;"|13
|300
|Пистолет большего размера стреляет очень громко. Надежное оружие для быстрого и кровавого убийства, так как большинство людей не могут вовремя среагировать, прежде чем в них выстрелят дважды. Изначально в нем заряжено 7 патронов, больше можно купить через аплинк или создать с помощью взломанного автолата.
{| class="wikitable sortable"
! class="unsortable" |icon
! class="unsortable" |Название
! class="unsortable" |ammo types
!cost
!threat
|-
|[[file:357_speedloader.png]]
| id="357_Speedloader" |.357 Ammo
|60 урона. Спидлоадер позволяет мгновенно перезарядить револьвер. Сам спидлоадер можно быстро наполнить, щелкнув по лежащим на земле патронам. Не будет переработан автолатом, если вы случайно нажмете на него.
| style="text-align: center;" |4
|300
|}
|Крайне смертоносные. Вводит в крит небронированную цель всего за два выстрела. Отлично подходит для засад, но в длительном бою может быть не так хорош.
|-
|style="text-align:center; background-color:#19A974;"|Да
|Toy Gun with Riot Darts
|[[file:Toy_gun.png]]
|style="text-align: center;"|2
|0
|<nowiki>Невинный на вид игрушечный пистолет, предназначенный для стрельбы пенными дротиками, идентично обычному игрушечному пистолету. В комплект входят дротики, способные вывести из строя цель. Не наносит летального урона, поэтому сочетайте его с чем-то подходящим для убийства.</nowiki>
{|class="wikitable sortable"
!class="unsortable"|icon
!class="unsortable"|Название
!class="unsortable"|ammo types
!cost
!threat
|-
|[[file:Foambox_riot.png]]
|id="Box_of_Riot_Darts"|Box of Riot Darts
|Стандартная коробка пенопластовых дротиков для игрушечного оружия. Покупайте, если вы не можете получить его из взломанного автолата, или повторно используйте те, которые вы выстрелили. Дротики наносят 25 урона выносливости.
|style="text-align: center;"|2
|0
|}
|Похож на [[disabler|дизейблер]], но проще заряжается.
|}

===Stealthy and Inconspicuous Weapons===
{|class="wikitable sortable"
!<abbr title="Can Nuclear operatives order this item?">Ops?</abbr>
!Item
!class="unsortable"|Icon
!Cost
!Threat
!class="unsortable"|Description
!class="unsortable"|Info
|-
|style="text-align:center; background-color:#FF4136;"|No
|id="Contractor_Baton"|Contractor Baton
|[[file:Contractor_baton_extended.png]]
|style="text-align: center;"|7
|0
|Компактная дубинка, по функционалу напоминающая телескопическую, но намного сильнее. Делает речь жертвы невнятной и работает на киборгов.
|Чрезвычайно полезен для похищений людей или в качестве оружия для самообороны, но имеет ярко-оранжевый цвет и издает громкий шум при ударе людей, поэтому все вокруг узнают, что вы предатель. Можно купить лишь одну.
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Dart_Pistol"|Dart Pistol
|[[file:Dart_pistol.png]]
|style="text-align: center;"|4
|0
|Миниатюрный шприцемет, заряжается шприцами с разнообразными химическими веществами. Можно зарядить только один шприц за раз, сам шприцемет помещается в карман. Как и обычный шприцемет он может быть крайне смертоносным, если вы знаете химию.
|Ищите [[Guide to chemistry|токсины]] в поисках идей для его наполнения. Или скомбинируйте с набором отравителя из аплинка.
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Dehydrated_Space_Carp"|Dehydrated Space Carp
|[[file:Carp_plush.png]]
|style="text-align: center;"|1
|0
|Выглядит как плюшевый игрушечный карп, но просто добавьте воды, и он станет настоящим космокарпом! Активируйте его в руке прежде чем использовать чтобы погладить, он запомнит вас и не будет пытаться убить. Правильно расположенный карп может представлять угрозу для безоружных и неробастных членов экипажа, но это по-прежнему относительно глупый симплмоб, поэтому не ждите, что он победит людей, которые знают, что делают. Также помните, что карпы неуязвимы для воздействия космоса.

|Классика ящика Синдиката.
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Energy_Dagger"|Energy Dagger
|[[file:Edagger.gif]]
|style="text-align: center;"|2
|0
|Ручка, которую можно активировать в руке, она станет энергетическим кинжалом, который наносит 18 грубых ударов при ударе и 35 при броске. Оно лучше большинства импровизированного оружия, дешевое и его легко спрятать, особенно в КПК. Хороший запасной вариант на случай, если раненой цели удастся выбить из ваших рук основное оружие.
|Его самое большое преимущество в том, насколько он незаметен. Убивает чуть быстрее, чем тулбокс, но имеет бронепробитие, позволяющее противостоять [[Security Officer|СБ]]. Помните, что обычно им достаточно ударить вас своей [[stun baton|дубинкой]] всего раз.
|-
|style="text-align:center; background-color:#FF4136;"|Нет
|id="Martial_Arts_Scroll" id="Carp_Style"|Martial Arts Scroll
|[[file:Sleeping_carp_scroll.png]]
|style="text-align: center;"|17
|300
|Этот свиток научит вас стилю Спящего Карпа, что сделает вас невосприимчивым к атакам дальнего боя пока активен '''боевой режим''', ваши удары кулаками станут сильнее, но также вы не сможете использовать дальнобойное оружие. Для прочтения свитка требуется время, дождитесь завершающего сообщения прежде чем бросать чтение. 
Стиль Спящего Карпа на данный момент имеет следующие эффекты:
* Вы не сможете использовать любое оружие дальнего боя, так как это бесчестье.
* Если «боевой режим» активен вы отражаете все атаки дальнего боя, будь то энергетические или баллистические (но не метательные предметы).
* Сопротивление некоторым [[Guide_to_Wounds|травмам]] (но не иммунитет).
* Ваши обычные удары наносят 10-15 урона.
* Захваты и толчки наносят урон выносливости в боевом режиме.
* Космокарпы не атакуют вас.
* Вы получаете возможность выполнять комбо-атаки.
* Цели с уроном по выносливости более 80 теряют сознание при захвате.
* Вы получаете черту '''heavy sleeper'''.
Вы выполняете шаг комбо, кликнув на цель определенным вариантом взаимодействия. По сути, вы нажимаете одним типом взаимодействия, ждете, пока пройдет время восстановления, равное 0,8 секунды, а затем снова нажимаете на того же человека следующей необходимой атакой.
{|class="mw-collapsible mw-collapsed" style="width:100%" border="1" cellspacing="0" cellpadding="2"
!scope="col" style="font-weight: bold;" style='background-color:#FA8778;'| Combo name
!scope="col" style="font-weight: bold;" style='width:160px; background-color:#FA8778;'| Combo
!scope="col" style="font-weight: bold;" style='background-color:#FA8778;'| Effect
!scope="col" style="font-weight: bold;" style='background-color:#FA8778;'| Attack message
|-
|'''Crashing Wave Kick'''
|{{Harm}} {{Disarm}}
|Жестко швыряйте людей через комнату подальше от себя. Наносит 15 урона.
|X kicks Y square in the chest, sending them flying!
|-
|'''Keelhaul'''
|{{Disarm}} {{Disarm}}
|Пинайте противников на пол, на 4 секунды [[Status_Effects#Knockdown|роняя]] их на пол, если они стоят. Это также дает цели слепоту и головокружение. Лежащим целям наносит 40 ед. урона выносливости и обезоруживает их.
|X kicks Y in the head, sending them face first into the floor! 
X kicks Y in the head!
|-
|'''Gnashing Teeth'''
|{{Harm}} {{Harm}}
|Наносит дополнительный урон каждый второй удар. 20 урона.
|Precisely kick, brutally chop, cleanly hit or viciously slam.
|}
|25+ players only
|-
|style="text-align:center; background-color:#FF4136;"|No
|id="Mini_Energy_Crossbow"|Mini Energy Crossbow
|[[file:Ebow.png]]
|style="text-align: center;"|10
|300
|Это оружие предназначено не для убийства, а для оглушения. Хотя при выстреле он и издает звук, но он крайне тихий и не дает никакого сообщения в чат о том, что из него стреляли. Легко спрятать в кармане, силен в сочетании с сильным оружием ближнего боя, например энергомечом. Не требует боеприпасов, но между выстрелами должен зарядиться некоторое время. По целям без энергетической брони каждый выстрел наносит 15 токсинового урона и 60 ед. урона выносливости, [[Status_Effects#Knockdown|сбивает с ног]] на 1 секунду и замутняет зрение цели. Требуется 2 попадания чтобы довести цель до [[Health#Stamina|стаминакрита]] (если цель не защищена от энергетического оружия).
|25+ players only
|-
|style="text-align:center; background-color:#FF4136;"|Нет
|id="Boxed_Origami_Kit"|Boxed Origami Kit
|[[file:Syndibox.png]][[file:Origami_book.png]]
|style="text-align: center;"|4
|100
|В этот набор входит книга «Искусство оригами» и 5 обычных листов бумаги. Активируйте книгу в руке, чтобы читать ее, пока не появится сообщение «Вы чувствуете, что хорошо разбираетесь в оригами!». После этого щелкните новый значок HUD, чтобы включить режим складывания оригами. Если эта функция включена, любой бумажный самолетик, который вы складываете (щелкнув по бумаге, удерживая клавишу Alt), превратится в смертоносное метательное оружие, которое так же, как обычный бумажный самолетик. Эти самолеты наносят 20 единиц грубого урона при броске и вызывают кровотечение. Жертвы, не носящие очков, также будут [[Status_Effects#Paralyze|парализованы]] на 4 секунды и получат урон по глазам. Эти самолетики всегда будут попадать людям в глаза, независимо от того, в какую часть тела вы целитесь.
|
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Poison_Kit"|Poison Kit
|[[file:Syndibox.png]]
|style="text-align: center;"|6
|0
|Этот набор содержит баночки по 30 юнитов [[Guide to chemistry#Polonium|Полония]], [[Guide to chemistry#Venom|Яда]], [[Guide to chemistry#Fentanyl|Фентанила]], [[Guide to chemistry#Formaldehyde|Формальдегида]], [[Guide to chemistry#Cyanide|Цианида]], [[Guide to chemistry#Histamine|Гистамина]], [[Guide to chemistry#Initropidil|Инитропидрила]], [[Guide to chemistry#Pancuronium|Панкурония]], [[Guide to chemistry#Sodium Thiopental|Тиопентала Натрия]], [[Guide to chemistry#Coniine|Кониина]], [[Guide to chemistry#Spewium|Спевиума]], [[Guide to chemistry#Curare|Кураре]] и [[Guide to chemistry#Amanitin|Аманитина]]. В комплекте содержится бесплатный шприц. Опытные химики, имеющие соответствующий доступ, могут счесть этот набор излишним, хотя он и содержит некоторые яды, которые иначе не достать.
|Отлично сочетается со шприцеметом. Или же вы можете отравить еду [[Cook|повара]] пока тот не смотрит.
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Romerol"|Romerol
|[[file:Syndibox.png]]
|style="text-align: center;"|25
|N/A
|[[Guide_to_chemistry#Romerol|Ромерол]] добавляет в жертву орган, вызывающий зомби инфекцию. Когда эти жертвы умрут, они возродятся в виде зомби, которые смогут заражать других людей. Его можно применить прямо на мертвых телах, позволяя создавать зомби из трупов в [[Morgue|морге]], или живым существам, чтобы превратить их в апокалиптическую бомбу замедленного действия!
|Действительно добавляет зомби-орган. В настоящее время его могут купить только ядерные оперативники. Обычные предатели могут получить его только для выполнения финальной цели.
|-
|style="text-align:center; background-color:#FF4136;"|Нет
|id="Sleepy_Pen"|Sleepy Pen
|[[file:pen.png]]
|style="text-align: center;"|4
|0
|Усыпляющая ручка по сути — инжектор мгновенного действия, замаскированный под обычную ручку. Он может вмещать до 45 юнитов реагентов, начиная с 20 юнитами [[Guide_to_chemistry#Chloral_Hydrate|Хлорал гидрата]], 15 юнитами [[Guide to chemistry#Mute_Toxin|Токсина немоты]], и 10 юнитами [[Guide to chemistry#Tirizene|Тиризина]], что не дает людям говорить и усыпляет примерно через 20 секунд. Они по-прежнему могут видеть и слышать все вокруг себя, пока не заснут. Разработайте план, который не позволит им сбежать или убить вас пока вы ждете начала действия веществ. Усыпляющую ручку также можно опорожнять и наполнять, как и любой другой контейнер, что позволяет мгновенно вводить до 45 единиц любого химического коктейля, который вам попадется в руки. Хорошо сочетается с набором ядов из аплинка. Если вы знаете химию, вы можете легко превратить его в устройство для смертельной инъекции. Независимо от содержимого ручки, жертва почувствует легкий укол, незаметный для окружающих. Кроме того, она не пробивает хардсьюты, МОДы и другое подобное защитное снаряжение.
|
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Universal_Suppressor"|Universal Suppressor
|[[file:Universal_suppressor.png]]
|style="text-align: center;"|3
|0
|Универсальный глушитель Синдиката для стрелкового вооружения. Если он прикреплен к оружию, при выстреле не выдается никакого сообщения, что позволяет застрелить человека до того, как он поймут, что происходит. Может быть установлен на такое оружие, как пистолет Макарова, Пистолет-пулемет C-20r, Снайперскую Винтовку или Surplus Rifle. Снимается при нажатии на оружие с зажатой клавишей ALT.
|
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Syndicate_Holster"|Syndicate Holster
|[[file:Syndicate_holster.png]]
|style="text-align: center;"|1
|0
|Пустой пояс-хамелеон, вмещающий до двух пистолетов, револьверов, дизейблеров, мини-энергетических пистолетов или импульсных карабинов. Ношение кобуры любого типа позволяет вам вращать оружие, держа его в руках. Выполнив это два раза подряд, вы сможете выбросить пули как обычно.
|Его можно замаскировать под любые другие ремни! Хорошо подходит для того, чтобы скрыть ваше незаконное оружие от глаз офицеров.
|}

=== Grenades and Explosives ===
'''All items available to nuclear operatives.'''
{|class="wikitable sortable"
!Item
!class="unsortable"|Icon
!Cost
!Threat
!class="unsortable"|description
!class="unsortable"|info
|-
|id="C4" id="Composition_C-4"|Composition C-4
|[[file:C4.gif]]
|style="text-align: center;"|1
|50
|Этот брикет пластида при взрыве уничтожает практически всё, на что он размещается, спустя выбранное количество времени (минимум 10 секунд). Используйте его в руке, чтобы установить таймер, а затем используйте его на том, к чему вы хотите его прикрепить; Настройка занимает 3 секунды и требует, чтобы вам не мешали. Вы также можете прикрепить сигналер для удаленного взрыва по своему желанию Можно разместить непосредственно на мобах, но он нанесет только 50 урона (примерно) и не гибнет. Будьте очень осторожны, чтобы не приклеить его к себе или рюкзаку!
|
|-
|id="Bag_of_C-4_Explosives"|Bag of C-4 Explosives
|[[file:Duffle_syndie.png]]
|style="text-align: center;"|8
|100
| Большая красно-черная спортивная сумка, в которой находится стопка C4. Дешевле покупать оптом, чем по одной, если вы считаете, что вам понадобится столько взрывчатки.
|
|-
|id="Bag_of_X-4_Explosives"|Bag of X-4 Explosives
|[[file:Duffle_syndie.png]]
|style="text-align: center;"|4
|200
|Содержит 3 заряда X4 в удобной спортивной сумке, которую можно использовать по своему усмотрению. X4 — более мощная версия C4, которая также наносит урон в конусе позади цели..
|
|-
|id="EMP_kit"|EMP Kit
|[[file:Syndibox.png]]
|style="text-align: center;"|2
|0
|ЭМИ-взрывы имеют множество применений: оглушение киборгов, отключение камер и гарнитур, истощение станпродов и энергетического оружия, нарушать работу АПЦ, открытие или шокирование дверей, ослепление тех, кто носит термальные импланты и многое другое. Чтобы использовать гранату, активируйте ее в руке и бросьте в ненавистную технологию. Имплантер функционирует так же, но после имплантации в себя его можно трижды активировать с помощью кнопки действия.
|
|-
|id="Detomatix PDA Cartridge" id="Detomatix"|Detomatix PDA Cartridge
|[[file:Pda cartrige.png]]
|style="text-align: center;"|6
|200
| Картридж для вашего [[PDA|КПК]]. Когда он вставлен, он позволит вам отправить сообщение-ловушку, чтобы попытаться взорвать [[PDA|КПК]] цели. При этом вы можете указать вымышленное имя и должность. Чтобы попытаться это сделать, вашей цели потребуется включить функцию обмена сообщениями на своем КПК. Попытка взорвать КПК имеет шанс на неудачу. Картридж можно использовать 4 раза и он может не сработать на КПК высокого уровня (Капитанский). Если цель ответит на сообщение или откроет вкладку сообщений в течение 10 секунд после его получения, КПК цели взорвется, уничтожив ID-карту, а получивший получит урон по телу и барабанным перепонкам.
|
|-
|id="Pizza_Bomb"|Pizza Bomb
|[[file:Pizza_bomb.gif]]
|style="text-align: center;"|6
|300
|Коробка для пиццы с хитро прикрепленной к крышке бомбой. Таймер необходимо установить, открыв коробку, вынув пиццу и использовав коробку в руке, а затем закрыть крышку с пиццей или без нее. После этого повторное открытие коробки вызовет детонацию по истечении таймера. В комплект входит бесплатная пицца для вас или вашей цели!
|
|-
|id="Slipocalypse" id="Slipocalypse_Clusterbang"|Slipocalypse Clusterbang
|[[file:clusterbang.png]]
|style="text-align: center;"|3
|0
|Традиционная кластерная граната, с начинкой из большого количества мыла Синдиката. Включите его и надейтесь, что все офицеры СБ комично поскользнутся на мыле и вылетят через шлюз.
|
|-
|id="Syndicate_Bomb"|Syndicate Bomb
|[[file:Syndicate_Bomb.gif]]
|style="text-align: center;"|11
|300
|Бомба Синдиката — это огромная, громоздкая взрывчатка с регулируемым таймером, минимум 90 секунд. При заказе бомбы вам будет отправлен небольшой маяк, который телепортирует взрывчатку к вам, когда вы его активируете. Сама бомба слишком велика, чтобы ее можно было взять в руки, потому придется таскать за собой, выпускайте ее только тогда, когда будете готовы. Когда взведете бомбу, '''прикрутите её к полу ключом''' Или кто-то просто вышвырнет её в космос. Пока бомба ведет обратный отсчет, она издает громкий звуковой сигнал, слышимый из соседних комнат. Если члены экипажа найдут её, они смогут использовать инструменты, чтобы открыть панель и получить возможность обрезать провода. Один случайно выбранный провод обезвреживает бомбу, а другой немедленно взорвет бомбу! Это можно использовать в своих интересах, выяснив провод детонации и добавив сигнализатор, чтобы вы могли контролировать момент взрыва бомбы; подумайте о краже тренировочной бомбы службы безопасности, чтобы узнать, какой провод отвечает за взрыв. Когда бомба взрывается, происходит огромный взрыв, который пробивает дыры в станции и разрушает окружающую территорию. Пламя вспыхивает повсюду, но почти сразу гаснет из-за воздействия космоса. Оперативникам синдиката следует обратить внимание на кнопку детонации, которая появляется в их штаб-квартире и которая при нажатии мгновенно взрывает каждую бомбу синдиката на z-уровне.
|
|-
|id="Syndicate_EMP_Bomb"|Syndicate EMP Bomb
|[[file:Syndicate_Bomb.gif]]
|style="text-align: center;"|7
|300
|Вариант бомбы Синдиката, предназначенной для создания сильного ЭМИ. При заказе бомбы вам будет отправлен небольшой маяк, который телепортирует её к вам, когда вы его активируете. Используйте так же, как и бомбу Синдиката (см. выше). Создает ЭМИ с дальностью действия 15 (сильное) и 25 (слабое).
|
|-
|id="Syndicate_Minibomb"|Syndicate Minibomb
|[[file:Syndicate_Minibomb.gif]]
|style="text-align: center;"|6
|300
|Минибомба — граната с пятисекундным взрывателем. Взрыв относительно небольшой, но пробивающий дыру в обшивке. Обычно она может сразу убить или даже гибнуть небронированную цель, хотя люди в броне могут выжить. Более грязная и дорогостоящая альтернатива использованию [[Makeshift_weapons#IED|IED]] на трупе.
|
|}

===Stealth and Camouflage Items===
{|class="wikitable sortable"
!<abbr title="Can Nuclear operatives order this item?">Ops?</abbr>
!Item
!class="unsortable"|Icon
!Cost
!Threat
!class="unsortable"|description
!class="unsortable"|info
|-
|style="text-align:center; background-color:#FF4136;"|No
|id="Chameleon_Kit"|Chameleon Kit
|[[file:Syndibox.png]]
|style="text-align: center;"|2
|0
|Хамелеон набор — это набор одежды, который можно легко настроить под любой внешний вид в игре. Вы можете менять вид вещей из набора по отдельности или все сразу на один из предустановленных комплектов. Маска имеет встроенный переключатель голоса, который можно включать и выключать, используя её в руке, он будет сопоставлять ваш голос с вашей текущей картой (идеально сочетается с картой агента!). От воздействия ЭМИ снаряжение хамелеона ломается и начинает быстро переключается между нарядами. Если вас не волнует выполнение целей, игра с ним может быть очень веселой. Вы также можете выбрать элементы экипировки из редких, доступных только для администраторов или даже удаленных предметов!

|Но не скиллкейп!
|-
|style="text-align:center; background-color:#FF4136;"|No
|id="No-Slips" id="No-Slip_Chameleon_Shoes"|No-Slip Chameleon Shoes
|[[file:Brshoe.png]] 
|style="text-align: center;"|2
|200
|Эти ботинки могут менять внешний вид, но в отличие от ботинок-хамелеонов из комплекта они еще и защищают от скольжения.
|От 20+ игроков. Хех.
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Agent_ID_Card" id="Agent_ID"|Agent ID Card
|[[file:Id_regular.png]]
|style="text-align: center;"|2
|0
|Карта агента имеет ряд полезных применений. Во-первых, вы можете по своему желанию изменить её внешний вид, имя и должность. Обратите внимание, что это не дает вам доступа само по себе, но ношение обычного противогаза может позволить вам замаскироваться под любого другого члена экипажа. Во-вторых, ношение этой карты означает, что ИИ не сможет легко вас отследить. Они по-прежнему смогут вас видеть, но не смогут выбрать ваше имя из списка своих камер, чтобы мгновенно перейти к вам и автоматически следовать за вами. Из-за этого им может быть трудно следовать приказу «закон 2: найди предателя». В-третьих, Бипски и другие охранные боты будут более снисходительны к владельцам идентификатора агента. Они используют систему «оценки угрозы», ношение агентской карты снижает эту угрозу на 2, то есть они будут игнорировать мелкие преступления, которые вы совершаете рядом с ними, если вы не накапливаете слишком много правонарушений. И наконец, нажатие на другую карту с помощью карты агента позволит вам выбрать до 5 доступов для копирования в зависимости от доступа целевой карты. Они сохраняются, даже если вы меняете её внешний вид.
У карты агента есть 5 [[Identification_Card#Wildcard_Slots|wildcard слотов]]: 3 стандартных, 1 командования и 1 капитанского уровня.
|
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Chameleon_Projector"|Chameleon Projector
|[[file:Chameleon projector.gif]]
|style="text-align: center;"|7
|0
|Использование хамелеон-проектора на предмете замаскирует вас под этот предмет. В маскировке вы двигаетесь со скоростью ходьбы и не можете взаимодействовать с чем-либо, кроме того что держите в руках, а если кто-то попытается вас поднять, маскировка спадёт и вы вернетесь в нормальное состояние. ИИ также не может отслеживать вас, пока вы замаскированы. Невероятно полезно и доставляет массу удовольствия, если использовать его правильно.
|
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Artificial_Intelligence_Detector" id="AI_Detector"|Artificial Intelligence Detector
|[[file:multitool.png]]
|style="text-align: center;"|1
|0
|Полностью функциональный мультитул, который становится красным, если находится в поле зрения ИИ. Если он близко, но еще не видит вас, он будет желтым. Знать, когда за вами наблюдает искусственный интеллект, полезно когда нужна незаметность. Недавно он элемент получил возможность отображать зону покрытия камер и место где находится камера-глаз ИИ.
|
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Smugglers_Satchel"|Smuggler's Satchel
|[[file:Smuggler.png]]
|style="text-align: center;"|1
|0
|Эта сумка предназначена для размещения под полом и поставляется вместе с ломом и плиткой. Его также можно поместить в рюкзак, что делает его отличным местом для хранения, поскольку в нем можно хранить предметы обычного размера.
 Кроме того, каждый раунд на станции случайным образом появляются сумки, в которых есть случайная контрабанда, например, наркотики или плакаты. Использование рентгеновского сканера позволяет увидеть их под плиткой.
|Раньше содержимое сумки сохранялось между раундами, но люди злоупотребляли этой функцией.
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Stimpack"|Stimpack
|[[file:Stimulant_medipen.png]]
|style="text-align: center;"|5
|0
|Этот медипен содержит 50 юнитов [[Guide_to_chemistry#Stimulantschem|Стимуляторов]], что значительно увеличит вашу скорость бега, уменьшит оглушение и даст небольшое лечение.
|
|-
|style="text-align:center; background-color:#FF4136;"|Нет
|id="Mulligan"|Mulligan
|[[file:Syringe.png]]
|style="text-align: center;"|4
|0
|Этот шприц поставляется с [[Guide_to_chemistry#Mulligan Toxin|Токсином Маллигана]], который навсегда изменит вашу внешность.
|
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="EMP_Flashlight"|EMP Flashlight
|[[file:flashlight.png]]
|style="text-align: center;"|4
|0
|Действует почти так же, как гранаты/имплантаты из комплекта ЭМИ, но он самозарядный, незаметный и более локальный. Может работать точно так же, как обычный фонарик, за исключением того, что когда вы ударяете им по чему-либо, предмет будет вести себя так, как если бы на него воздействовало ЭМИ. Всего 4 заряда, восстанавливаются со временем. Удар по человеку отключит его гарнитуру и любое энергетическое оружие, которым он обладает, а удар по киборгу повредит и оглушит его. Использование его на дверях может лишить их мощности или электризовать.
|
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Radio_Jammer"|Radio Jammer
|[[file:radio_jammer.png]]
|style="text-align: center;"|5
|0
|При активации это устройство заблокирует любую исходящую радиосвязь поблизости. Активируйте его и положите в карман или рюкзак, прежде чем убить кого-нибудь, чтобы он не мог позвать СБ.
|
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Codespeak_Manual"|Codespeak Manual
|[[file:Red_book.png]]
|style="text-align: center;"|3
|0
|Это руководство научит вас и всех, кого им ударить, Кодспику, звучащий для непосвященных как случайные термины и напитки. Неограниченное использование. Используйте ,t, прежде чем что-то сказать на Кодспике.
|
|-
|Да
|GLA Brand Mail counterfeit Device
|[[File:Mail_counterfeit_device.png]]
|style="text-align: center;"|1
|0
|Устройство, способное подделывать письма NT. Оно способно размещать внутри письма ловушку для разных козней. Ловушка «активирует» любой предмет внутри письма. Также его могут использовать в контрабандных целях.
|Карготехники и КМ могут купить его по более низкой цене.
|-
|Нет
|Disable Telecomms
|
|4
|150
|При покупке вирус будет загружен на сервера телекоммуникаций, временно отключив их.
|Единоразовая покупка.
|-
|Нет
|Trigger Stationwide Blackout
|
|6
|200
|При покупке вирус приведет к временному отключению всех ЛКП на станции.
|Единоразовая покупка.
|}

===Armor===
{|class="wikitable sortable"
!<abbr title="Can Nuclear operatives order this item?">Ops?</abbr>
!Item
!class="unsortable"|Icon
!Cost
!Threat
!class="unsortable"|description
!class="unsortable"|info
|-
|style="text-align:center; background-color:#19A974;"|Да
|id="Syndicate_Space_Suit"|Syndicate Space Suit
|[[file:Syndi_suit.png]]
|style="text-align: center;"|4
|0
|Специальный скафандр Синдиката, который помещается в рюкзак, замедляет слабее стандартного EVA и имеет слот для оружия. Однако цвет у него довольно подозрительный. Сопротивления: melee = 40, bullet = 50, laser = 30, energy = 15, bomb = 30, bio = 30, rad = 30, fire = 80, acid = 85.
|-
|style="text-align:center; background-color:#FF4136;"|Нет
|id="Blood-red_Hardsuit"|[[MODsuits#Syndicate MODsuit|Syndicate MODsuit]]
|[[file:Syndiemod_inactive.png]]
|style="text-align: center;"|8
|200
|Внушающий страх МОД Синдиката, используемый ядерными оперативниками. Имеет специальный мод «Armor Booster», который повышает броню пользователя в обмен на защиту от воздействия открытого космоса при включении. В боевом режиме имеет следующие сопротивления:
melee = 40, ballistic = 50, laser = 30, energy = 40, bomb = 35, biological = 100, fire = 50, acid = 90, wounds = 25
|По правде говоря, ядерные оперативники не могут купить его.
|-
|style="text-align:center; background-color:#19A974;"|Да
|[[MODsuits#Elite Syndicate MODsuit|Elite Syndicate MODsuit]]
|[[File:Elite MOD control.png|alt=]]
|style="text-align: center;"|16
|900
|Внушающий страх МОД Синдиката, используемый ядерными оперативниками. Имеет специальный мод «Armor Booster», который повышает броню пользователя в обмен на защиту от воздействия открытого космоса при включении. В боевом режиме имеет следующие сопротивления:
melee = 60, ballistic = 60, laser = 50, energy = 60, bomb = 55, biological = 100, fire = 100, acid = 100, wounds = 25
|
|-
|style="text-align:center; background-color:#FF4136;"|Нет
|id="Infiltrator_set"|Infiltrator MODsuit
|[[file:Infiltrator_case.png]]
|style="text-align: center;"|6
|0
|Этот специальный МОД-костюм не защищает от вакуума и крепится на поясе, однако он не замедляет, обеспечивает высокую устойчивость к повреждениям и полную анонимность. Этот костюм также имеет модуль, вызывающий плохие мысли у находящихся рядом сотрудников НТ, снижая их настроение.
|Можно купить лишь один. '''НЕ ЗАЩИЩАЕТ ОТ ВАКУУМА!!!'''
|-
|style="text-align:center; background-color:#19A974;"|Да
|Thermal Vision MOD
|[[File:Thermal_visor.png]]
|3
|0
|Модуль для МОД-костюма, который дает пользователю термальное зрение.
|
|-
|style="text-align:center; background-color:#19A974;"|Да
|Night Vision MOD
|[[File:Night_visor.png]]
|2
|0
|Модуль для МОД-костюма, который дает пользователю ночное зрение.
|
|-
|Да
|Plate compression MOD
|
|2
|0
|Модуль, позволяющий помещать костюм в рюкзак, несовместим с модулями хранения или МОДом инфильтратора .
|
|-
|Да
|Chameleon MOD
|
|2
|0
|Модуль который позволяет блоку управления МОД-костюма (его основная часть, которая крепится на спину) маскироваться под другие объекты, например рюкзак.
|
|-
|Да
|Anti-Slip MOD
|
|2
|0
|Модуль для МОД-костюма, который защищает владельца от комичного подскальзывания на мокром полу.
|
|}

===Devices and Tools===
'''All items available to nuclear operatives.'''
{|class="wikitable sortable"
!Item
!class="unsortable"|Icon
!Cost
!Threat
!class="unsortable"|description
!class="unsortable"|info
|-
|id="Cryptographic_Sequencer"|[[Emag|Cryptographic Sequencer]]
|[[file:emag.gif|32px]]
|style="text-align: center;"|4
|0
|ID карта ассистента с приделанной к ней электроникой и нарисованной буквой "S", '''до боли знакомая всем на станции''' . После использования ЕМАГа, предметы зачастую искрят. Соблюдайте осторожность при его использовании и будьте готовы к тому, что вас могут застать за незаконной деятельностью.

ЕМАГ может взломать практически любую [[ЕМАГ|электронику]] на станции. Используется для взлома боргов, саботажа и порчи дня инженерам. Можно спрятать в кошельке.
|'''Не взламывает шлюзы'''
|-
|id="Airlock_Override" id="Airlock_Authentication_Override" id="Airlock_Authentication_Override_Card"|Airlock Authentication Override Card
|[[file:Syndicate_doorjack.png]]
|style="text-align: center;"|3
|0
|Специализированный ЕМАГ, разработанный для взлома шлюзов. Взломанные двери выбрасывают очень заметные искры, когда вы используете его, как и его более известный брат, поэтому соблюдайте осторожность, чтобы не быть раскрытым. Всего имеет 3 самовосстанавливающихся заряда, каждый из которых имеет собственный таймер (3 минуты) между использованиями. Не открывает заболтированные и заваренные двери. Как и ЕМАГ, спокойно помещается в кошелёк.
|Открывает только шлюзы.
|-
|id="Camera_Bug"|SyndEye Program
|[[file:camera_bug.gif]]
|style="text-align: center;"|1
|0
|Диск с данными, содержащий уникальное приложение, которое позволяет вам наблюдать за камерами и отслеживать членов экипажа. Загрузите его на свой КПК чтобы отслеживать свои цели!
|
|-
|id="Syndie_toolbox" id="Fully_Loaded_Toolbox"|Fully Loaded Toolbox
|[[file:Syndicatetools.png]]
|style="text-align: center;"|1
|0
|Это подозрительно выглядящий тулбокс, наполненный полезными инструментами. Содержит: [[File:Screwdriver tool.png|link=Screwdriver]], [[File:Wrench.png|link=Wrench]], [[File:Welder.png|link=Welding Tool]], [[File:Crowbar.png|link=Crowbar]], [[File:Multitool.png|link=Multitool]], [[File:Wirecutters.png|link=Wirecutters]], и пару [[Clothing_and_Accessories#Combat_Gloves|боевых перчаток]] (защищают от тока). Кроме того, он покрепче обычного тулбокса.
|
|-
|id="Adaptative_Cardboard_Cutouts"|Adaptive Cardboard Cutouts
|[[file:Syndibox.png]]
|style="text-align: center;"|1
|0
|В этой коробке находятся три картонных фигурки и мелок, которым можно их раскрасить. В отличие от обычных картонных фигурок, эти не имеют характерного желтого оттенка, что делает их удобными для обмана доверчивого экипажа или ИИ.
|
|-
|id="Decoy_Nuclear_Authentication_Disk"|Decoy Nuclear Authentication Disk
|[[file:NuclearDisk.gif]]
|style="text-align: center;"|1
|0
|Фальшивый ядерный диск. Визуально он идентичен реальному, и только [[Captain|капитан]] или ядерные оперативники могут отличить подделку.
Не пытайтесь впарить его <s>нам</s> Синдикату для сдачи цели, они вас раскусят!
|
|-
|id="Hypnotic_Flash"|Hypnotic Flash
|[[file:flash.gif]]
|style="text-align: center;"|7
|0
|Гипнотизирует людей, заставляя их следовать следующей фразе, которую они услышат. Чтобы сработало, игрок не должен быть имплантированным [[Security_items#Mindshield_Implant|имплантом защиты разума]].Кроме того, для успеха цель должна [[Status_Effects#Hallucinations|испытывать галлюцинации]], [[Status_Effects#Sleep|спать]], иметь крайне низкое значени рассудка, страдать от [[Guide_to_Traumas#Mild|травмы глупости]], [[Status_Effects#Unconscious|быть без сознания]] или опьяненной. Состояние крита не считается. Вызывает замешательство, головокружение, сонливость и умиротворение как при нецелевой (используйте в руке), так и при направленной (нажмите на спрайт) вспышке, но для гипноза требуется направленная. Если вы успешно зафлешите уязвимого человека, вы увидите сообщение о том, что "''Name stands still as his/her eyes seem to focus on a distant point.''". В этот момент вам требуется произнести нужную фразу, даже если жертва спит. Повтор процесса на уже загипнотизированной жертве заменит старую фразу.
В отличии от обычной флешки, эта не перегорает и не оглушает.
|
|-
|id="Hypnotic_Grenade"|Hypnotic Grenade
|[[file:flashbang.gif]]
|style="text-align: center;"|12
|0
|Эта светошумовая граната способна вызвать [[Guide_to_Traumas#Severe|гипнотический ступор]] у уязвимых людей. Как только им прозвучит вспышка, они будут загипнотизированы первым услышанным предложением и приобретут навязчивое желание подчиниться ему. В отличие от гипнотического флеша, не требует вводить цели в состояние транса.
|
|-
|id="Syndicate_Surgery_Duffelbag"|Syndicate Surgery Duffelbag
|[[file:Duffle_syndiemed.png]]
|style="text-align: center;"|4
|0
|Используйте его для совершения хирургических преступлений. Содержит набор продвинутых хирургических инструментов, костный гель, костоправ, кляп, смирительную рубашку и пустой ММИ Синдиката, подчиняющий борга вам.
|Инструменты в нем не получить без продвинутых исследований.
|-
|id="Chest_Rig"|Chest Rig
|[[file:Chest_rig.png]]
|style="text-align: center;"|1
|0
|Крепкая разгрузка на семь слотов, способна вместить любое тактическое снаряжение.
|
|-
|id="Syndicate_Tome"|Syndicate Tome
|[[file:Syndicate_tome.png]]
|style="text-align: center;"|5
|0
|Как библия священника, но для предателей. Не благословляет воду или комнаты, но может исцелять других, как это делает Библия. Пользователю необходимо привязать фолиант к себе, используя его в руке (фолиант кусает вас в качестве подтверждения). В харм интенте наносит 18 урона ожогами. Также даёт иммунитет к магии и возможность очищать руны [[Blood Cult|культа]] и [[heretic|еретика]].
|18 урона — это не очень много, но главная ценность здесь — антимагия, которая спасет вас при борьбе с [[Blood Cult|культистами]], [[Heretic|еретиками]] и [[Wizard|магами]]!
|-
|id="Thermals" id="Thermal_Imaging_Glasses"|Thermal Imaging Glasses
|[[file:Optical_Thermal_Scanner.png]]
|style="text-align: center;"|4
|0
| При ношении этот предмет позволяет вам видеть сквозь стены любого человека, чужого, киборга и даже ИИ. Можно замаскировать под любые очки. Их ношение делает вас очень уязвимым для [[Security_items#Flash|флешей]], [[Security_items#Flashbang|светошумовых]] и ЭМИ. Использование сварки с надетыми очками может привести к слепоте.
|
|-
|id="Binary_Translator_Key"|Binary Translator Key
|[[file:Binary_encryption.png]]
|style="text-align: center;"|5
|0
|Вставьте его в гарнитуру, чтобы получить доступ к каналу :binary, который используют борги и ИИ. Если ваша гарнитура заполнена, с помощью отвертки извлеките ключи, уже находящиеся в гарнитуре, и вставьте обратно те, которые вам нужны. Все ключи имеют доступ к общему каналу, поэтому, если у вас есть «общий» ключ, вы можете его без проблем выбросить. Хотя общение по каналу :binary возможно, это не рекомендуется, так как ИИ быстро поймет, что вы не борг. Также помните, что любой может услышать, что вы говорите по радио, если находится рядом с вами.
|
|-
|id="Syndicate_Encryption_Key"|Syndicate Encryption Key
|[[file:Syndicate encryption.png]]
|style="text-align: center;"|2
|0
|Вставьте его в гарнитуру, чтобы прослушивать все радиоканалы станции и говорить по скрытому каналу Синдиката с другими предателями, использующими ключ. Если ваша гарнитура заполнена, используйте отвертку, чтобы извлечь ключи, уже находящиеся в гарнитуре. Для разговора в канале Синдиката поставьте :t перед текстом. '''Помните, что другие предатели не обязаны быть к вам дружелюбными.'''
|
|-
|id="Hacked_AI_Upload_Module"|Hacked AI Upload Module
|[[file:circuitboard.png]]
|style="text-align: center;"|4
|300
|Более сильная версия [[AI_modules#Standard_AI_Modules|Freeform]] ИИ модуля. Он позволяет загружать взломанные законы в ИИ с любой консоли загрузки. В отличие от Freeform, имя загрузившего файл не раскрывается ИИ. Эти законы действуют как [[Random_events#Ion_Storm|ионные]] и будут предшествовать пронумерованным законам по приоритету, автоматически отменяя все другие законы в случае их противоречия.
|
|-
|id="Powersink"|Powersink
|[[file: Powersink.gif]]
|style="text-align: center;"|11
|300
|Эта малышка худший враг ИИ и инженеров. При подключении к электросети она начинает '''КРАЙНЕ''' быстро выкачивать энергию. Необходимо прикрутить его на провод с помощью отвертки, а затем включить. Снять её так же просто, как и установить, убедитесь, что её на не найдут в первые две минуты работы. Накопив достаточно энергия она взорвется, разнося все, что было поблизости!
|25+ players only
|-
|id="Ominous_Beacon" id="Singularity_Beacon" id="Tesla_Beacon"|Ominous Beacon
|[[file:Beacon.gif]]
|style="text-align: center;"|10
|300
|Размещается как и Power Sink. Отвертка позволяет закрепить ее на оголенном узле проводки (хотя бы 15,000 ватт), для начала работы его нужно включить. Маяк будет притягивать сингулярность или теслу, если те покинут зону содержания.
|
|-
|id="Briefcase_Launchpad"|Briefcase Launchpad
|[[file:Briefcase_launchpad.gif]]
|style="text-align: center;"|6
|0
| Кейс с миниатюрным лаунчпадом, способным телепортировать объекты и мобов на расстояние до 8 клеток в любом направлении. Он управляется с помощью пульта дистанционного управления, замаскированного под папку, что позволяет пользователю использовать его при побеге. Для привязки пульта просто кликните им по кейсу. Для настройки телепорта нажмите кейс в руке.
|
|-
|id="Radioactive_Microlaser"|Radioactive Microlaser
|[[file:Healthanalyzer.png]]
|style="text-align: center;"|3
|0
|Радиоактивный микролазер, замаскированный под стандартный анализатор здоровья НТ. При использовании он излучает мощный импульс, который после некоторого времени может вывести из строя почти кого угодно. Имеет две настройки: интенсивность, которая контролирует мощность излучения, и длину волны, которая контролирует длительность задержки излучения.
|
|-
|id="F.R.A.M.E._PDA_Cartridge"|F.R.A.M.E. PDA Cartridge
|[[file:Pda_cartrige.png]]
|style="text-align: center;"|4
|0
|Картридж для КПК. Имеет пять зарядов, и при использовании он откроет на КПК цели аплинк Синдиката с 0 ТК. Вы также получите код, необходимый для разблокировки КПК. Вы можете поместить ТК напрямую в картридж, при следующем использовании на заблокированном аплинке будет та сумма телекристаллов, которую вы внесли в картридж.
|
|-
|id="Syndiecate_Soap"|Syndicate Soap
|[[file:Synsoap.png]]
|style="text-align: center;"|1
|0
|Кусочек злодейски выглядящего мыла. Он может смыть кровь с земли или с вашей одежды. Также подсказльзывает людей. Полезно с энергетическим мечом. Кроме того, оно очищает вещи намного быстрее, чем обычное мыло, что делает его удобным для быстрой очистки.
|
|-
|id="Protocol_Crab-17_Phone"|Protocol CRAB-17 Phone
|[[file:Suspicious_phone.png]]
|style="text-align: center;"|7
|0
|Это устройство позволяет вам запустить другое устройство, которое переводит средства всех членов экипажа на ваш банковский счет. При использовании телефон начнет красть средства экипажа с их счетов, создав движущийся рынок космической валюты в случайном месте, по которому нужно провести картой, чтобы остановить перевод денег.
|Купить можно только один.
|-
|id="Polarized Contact Lenses"|Polarized Contact Lenses
|[[File:Syndicate_contacts.png]]
|style="text-align: center;"|3
|0
|Высокотехнологичные контактные линзы, которые прикрепляются непосредственно к поверхности глаз, обеспечивая им невосприимчивость к вспышкам и яркому свету. Эффективно, недорого и практически незаметно.
|Поможет против [[Security Officer|СБ]] и [[Revolutionaries|революционеров]]
|-
|Tram Remote Control
|
|2
|0
|При подключении к компьютерным системам трамвая это устройство позволяет пользователю удаленно управлять им. Может переключать направление и скоростной режим для обхода проверок безопасности.
|
|-
|Failsafe Uplink Code
|
|1
|0
|Взрывает аплинк при входе в него. Ваша последняя шутка для очень любопытного офицера.
|
|-
|Super Pointy Tape
|
|1
|0
|Многоцелевая суперклейкая лента. В рулоне 5 мотков. Предметы, на которые она нанесена, воткнутся в того кого попадут. Если заклеить ею рот, то при снятии будет нанесен урон.
|Полезно для разнообразных бомб-липучек.
|-
|Experimental Syndicate Teleporter
|[[File:Syndicate_teleporter.gif]]
|8
|0
|Устройство, телепортирующее вас на 4-8 тайлов вперед. Будьте осторожны: телепортация в стену активирует срабатывание экстренного телепорта, который попробует сместить вас на 3 тайла в случайном направлении, при неудаче вас гибнет. Всего может иметь 4 заряда, перезарядка случайная, но быстрая. При ЭМИ телепортирует в случайном направлении. Если каким-то чудом вы телепортируетесь прямиком на кого-то, то ему будет нанесено 20 грубого урона, а сам он будет оглушен. Каждое использование оставляет 10 юнитов вашей крови на полу.
|Очень сильный, особенно за свою цену и с учетом того, что он не требует какого-то уровня репутации. Идеально подходит для побега и взломов.
|-
|Syndicate Autosurgeon
|
|5
|0
|Многоразовый авто-хирург для имплантации всего, чего пожелаете. Вставьте в него имплант и примените в руках.
|Доступно только на станциях с чертой "Cybernetic Revolution".
|}

===Implants===
'''All items available to nuclear operatives.'''
{|class="wikitable sortable"
!Item
!class="unsortable"|Icon
!Cost
!Threat
!class="unsortable"|description
!class="unsortable"|info
|-
|id="Freedom_Implant"|Freedom Implant
|[[file:injector.png]]
|style="text-align: center;"|5
|0
|С этим имплантом можно моментально освободиться от [[Security_items#Handcuffs|наручников]] и бол 4 раза. Будьте осторожны: если СБ поймет, что вы можете вырваться из наручников, они, как правило, предпочтут казнить вас на месте, а не арестовывать.

|
|-
|id="Storage_Implant"|Storage Implant
|[[file:injector.png]]
|style="text-align: center;"|8
|0
|Имплант, вводимый в тело, а затем активируемый по желанию пользователя. Он откроет небольшой блюспейс карман, в котором можно хранить два предмета обычного размера. Невозможно невозможно обнаружить без [[Surgery|хирургической операции]].
|
|-
|id="Radio_Implant"|Internal Syndicate Radio Implant
|[[file:injector.png]]
|style="text-align: center;"|4
|0
|Имплантирует вам скрытое радио с доступом к общему и секретному каналу синдиката (:t). Как и в случае с обычным радио, вы можете отключить его, чтобы избежать подозрений. Устойчив к ЭМИ, но не может быть модифицирован с помощью ключей шифрования.
|-
|id="Stealth_Implant"|Stealth Implant
|[[file:Cardboard_box.png]]
|style="text-align: center;"|8
|0
|Этот имплантат разворачивает вокруг вас картонную коробку, которая мгновенно становится невидимой. Если она столкнется с живым существом или то будет временно раскрыта.
|
|-
|id="Uplink_Implant"|Uplink Implant
|[[file:injector.png]]
|style="text-align: center;"|4
|0
|Имплант предоставляющий доступ к аплинку Синдиката. Изначально не имеет ТК, но вы можете достать их из старого аплинка и нажатием по себе пополнить счет импланта.
|
|}

===Race Restricted===
'''No item available to nuclear operatives, as they are humans''' (AI door!). 
{|class="wikitable sortable"
!Item
!class="unsortable"|Icon
!Race
!Cost
!Threat
!class="unsortable"|description
!class="unsortable"|info
|-
|id="Extra-Bright_Lantern"|Extra-Bright Lantern
|[[file:Syndilantern.png]]
|[[file:moths.gif]] [[Moth]]s
|style="text-align: center;"|2
|0
|Мы слышали, что такие мотыльки, как вы, просто обожают лампы, поэтому решили предоставить вам ранний доступ к прототипу "сверхяркого фонаря™" бренда «Syndicat». Наслаждайтесь.
|
|}

===Role Restricted===
'''No item available to nuclear operatives, they <s>do it for free</s> don't have jobs!'''

'''Все предметы для определенной должности так же доступны главам отдела. У ГП нет своего отдела.'''
{|class="wikitable sortable"
!Item
!class="unsortable"|Icon
!Role
!Cost
!Threat
!class="unsortable"|description
!class="unsortable"|info
|-
|Clumsiness Injector
|
| rowspan="8" |[[file:clown.png]] [[Clown]]
|1
|0
|Уколотый инъектором получит генетическую мутацию неуклюжести.
|
|-
|Ultra Hilarious Firing Pin
|
|4
|0
|Оружейный ударник. Будучи вставленным в оружие позволит нормально стрелять из него только клоунам и людям с мутацией неуклюжести. Остальные стреляющие из него будут хонкнуты.
|
|-
|Super Ultra Hilarious Firing Pin
|
|7
|0
|Похожа на ultra hilarious firing pin, но при использовании несмешными членами экипажа (без гена неуклюжести) оружие взорвется.
|
|-
| id="Reverse_Bear_Trap" |Reverse Bear Trap
|[[file:Reversebeartrap.png]]
| style="text-align: center;" |5
|0
|Гениальное устройство для казни, надеваемое на голову. При активации включается таймер на 1 минуту. Когда он сработает, челюсти капкана резко схлопнутся, мгновенно убивая любого, кто носит его. Для установки атакуйте им человека без головного убора, для этого требуется 3 секунды стоять неподвижно. Жертва может попытаться обезвредить его. Каждая попытка обезоружить увеличивает шансы на успех.
|
|-
| id="Banana_Cream_Pie_Cannon" |Banana Cream Pie Cannon
|[[file:Pie_cannon.png]]
| style="text-align: center;" |10
|100
|Особенная пироговая пушка для особенного клоуна. Вмещает до 20 пирогов и генерирует новый каждые 2 секунды.
|
|-
| id="Reverse_Revolver" |Reverse Revolver
|[[file:revolver.png]]
| style="text-align: center;" |14
|300
|Из этого револьвера с особым ударником могут стрелять только неуклюжие люди. Все прочие выстрелят себе прямо в лицо.
|
|-
| id="Clown_Bomb" |Clown Bomb
|[[file:Syndicate_Bomb.gif]]
| style="text-align: center;" |15
|150
|Бомба выпускающая 50 клоунов. Они хонкают.
|
|-
| id="Clown_Car" |Clown Car
|[[file:Clowncar.png]]
| style="text-align: center;" |20
|50
|Клоунская машинка позволяет запихивать внутрь сбитых ею людей. Они не смогут убежать, если вы не врежетесь в стену, которая выбросит вас и всех пассажиров наружу! Поставляется с гудком, кнопкой для освобождения всех пассажиров и механизмом смазочной защиты(tm) с 30% шансом выпускающий лужу смазки, если кто-то дерзнет выстрелить в неё. Если у вас выйдет её ЕМАГнуть, вы получите еще больше веселья! Только клоуны могут водить машинку, ключом служит их гудок. Чинится банановой кожурой. Остерожно - если вы подберете кого-то, у кого есть 30 юнитов [[Irish Car Bomb]] в теле, машина взорвется спустя 5 секунд!
|
|-
| id="Guide_to_Advanced_Mimery" |Guide to Advanced Mimery Series
|[[file:advanced mimery.png]][[file:advanced mimery.png]]
| style="text-align: center;" |[[file:mime.png]] [[Mime]]
| style="text-align: center;" |12
|200
|Классический двухтомник по улучшению навыков пантомимы. После прочтения вы сможете создавать невидимые стены размером 3x1 и стрелять пулями из пальца. Книги не исчезают после прочтения, так что постарайтесь спрятать или уничтожить улики.
|
|-
| id="Ancient_Toolbox" |Ancient Toolbox
|[[file:testbox.png]]
| rowspan="2" style="text-align: center;" |[[file:assistant.png]] [[Assistant]]
| style="text-align: center;" |2
|0
| Тулбокс разработанный для удовлетворения вашей потребности в робасте, содержит обычные инструменты и [[Insulated Gloves|изоляционные перчатки]], Но главное в нем - чем больше ТК внутри, тем сильнее он бьет!
|В настоящее время недоступен.
|-
| id="Ancient_Jumpsuit" |Ancient Jumpsuit
|[[file:grey_jumpsuit.png]]
| style="text-align: center;" |20
|0
|Старый вонючий серый комбез, этот предмет не дает никаких преимуществ или недостатков, кроме возможности похвастаться.
|
|-
| id="EZ_clean_bundle" |EZ clean bundle
|[[file:Grenade.png]]
| style="text-align: center;" |[[file:janitor.png]] [[Janitor]]
| style="text-align: center;" |6
|0
|Эта набор из 3-х нелегальных чистящих гранат от Waffle Co. содержащих реагент торговой марки "ez clean", гарантированно удаляющий любую органику. Особо эффективен в многолюдных коридорах.
|
|-
| id="His_Grace" |His Grace
|[[file:His_Grace.gif]]
| style="text-align: center;" |[[file:chaplain.png]] [[Chaplain]]
| style="text-align: center;" |20
|50
| Его Светлость — могущественная сущность, которая может наделить огромной силой. При покупке он спит, используйте его в руке, чтобы активировать. После активации и привязки к игроку начинается голод. По мере того, как Его Светлость становится все голоднее, он дает своему владельцу различные усиления.
*Сперва он немного голоден, давая небольшой бонус к урону.
*Голод растет, давая больше урона и небольшое лечение носителю. Если он окажется на полу, то начнет поглощать любого, кто пройдет рядом.
*Усиление голода приводит к тому, что урон и исцеление становятся значительными, но он больше не отпустит вашу руку.. '''ИЩИ ЕДУ'''.
*'''ГОЛОДАНИЕ: ТЫ СДЕЛАЛ ЭТО'''. По сути, вы — халк с огромной регенерацией. Я надеюсь, что вы прочтете это руководство заранее, потому что вам осталось жить около десяти секунд пере-
*'''СМЕРТЬ''': ты мертв. Он слишком проголодался, Его Светлость отгрыз тебе руку и раздавил голову как спелую виноградину. В этот момент счетчик сбрасывается, Его Светлость в последний раз ложится на землю и, если ни один ассистент не подойдет слишком близко, снова впадает в спячку от голода. Тела можно доставать из его челюстей, а генокрады могут ожить и выползти наружу.
*'''ВОЗВЫШЕНИЕ''': Если Его Светлость съел 25 людей, то станет золотым, наберёт дополнительную силу и никогда больше не уснет. Он всегда останется на текущем уровне голода.
|
|-
| id="Haunted_Magic_Eightball" |Haunted Magic Eightball
|[[file:eightball.png]]
| style="text-align: center;" |[[file:librarian.png]] [[Curator]]
| style="text-align: center;" |2
|0
|Как и в игрушечной версии, в этом шаре-восьмерке есть двадцать ответов. Игрушечная версия просто выбирает их случайным образом, в то время как эта версия опрашивает всех призраков, а затем выбирает самый популярный ответ, выбранный ими. Чтобы использовать, его необходимо встряхивать в течение 15 секунд после того, как вы произнесли свой вопрос вслух, а затем между использованиями должен пройти 3-минутный период восстановления. Призрачные и игрушечные шары неотличимы друг от друга, кроме качества ответов. Призраки — штука непостоянная, и неизвестно, помогут они вам или нет. '''В данное время предмет забагован и не работает'''
|Купить можно лишь один.
|-
| id="Box_of_Gorilla_Cubes" |Box of Gorilla Cubes
|[[file:Monkey_Cube_Box.png]]
| rowspan="3" style="text-align: center;" |[[file:Geneticist.png]] [[Geneticist]]
[[Research Director|RD]]
| style="text-align: center;" |6
|150
|Коробка с тремя кубами-гориллами от Waffle Co. Похожи на [[Research_items#Monkey_Cube|обезьяньи кубы]], но выпускают разъяренных [[Critters#Gorilla|горилл]] при контакте с водой.
|Вы можете мутировать обезьян в гориллу, нанеся им достаточно генетических повреждений (>2500), тем не менее это очень долго и не стоит того.
|-
| id="Modified_Syringe_Gun" |Modified Syringe Gun
|[[file:sgun.png]]
| style="text-align: center;" |14
|0
|Шприцемет стреляющий ДНК-инъекторами вместо обычных шприцев.
|
|-
| id="Magillitis_Serum_Autoinjector" |Magillitis Serum Autoinjector
|[[file:Bottle16.png]]
| style="text-align: center;" |15
|100
|Содержит [[Guide_to_chemistry#Magillitis|химикат]] превращающий использовавшего в быструю, сильную [[Critters#Gorilla|гориллу]] через какое-то время.
|В теории, если достать мозг из тела гориллы и вставить в пустое тело, человека, которому сделали инъекцию, можно вернуть обратно.
|-
| id="Blast_Cannon" |Blast Cannon
|[[file:Loaded_blastcannon.png]]
| style="text-align: center;" |[[file:Scientist_generic.png]] [[Scientist]]
[[Research Director|RD]]
| style="text-align: center;" |14
|300
|Этот неприметный кусок металла может запускать TTV по прямой линии, пока та не врежется в стену. Пробивная способность определяется теоретическим размером взрыва бомбы.
|
|-
| id="Concealed_Weapon_Bay" |Concealed Weapon Bay
|[[file:Mecha_weapon_bay.png]]
| rowspan="3" style="text-align: center;" |[[file:roboticist.png]] [[Roboticist]]
[[Research Director|RD]]
| style="text-align: center;" |3
|300
|Скрытый оружейный отсек — это предмет, который крепится к небоевым [[Guide_to_robotics#List_of_Exosuits|мехам]] вроде [[Guide_to_robotics#Ripley_APLU|Рипли]] или [[Guide_to_robotics#Odysseus|Одиссея]] позволяя устанавливать на них [[Guide_to_robotics#Exosuit_Weapons|вооружение для мехов]]. Предоставляет всего один слот для оружия. При осмотре прикрепленное оружие незаметно (хотя сообщение о поднятии все еще отображается).
|
|-
| id="Laser_Arm_Implant" |Laser Arm Implant
|[[file:Syndicate_autoimplanter.png]]
| style="text-align: center;" |10
|200
|Имплант, который дает вам самозарядный лазер внутри вашей руки. Уязвим к ЭМИ. Поставляется с одноразовым автохирургом Синдиката для немедленного самостоятельного применения. Чтобы удалить его из автохирурга, можно использовать отвертку, но имплант нельзя вставить обратно.
|
|-
|Heavily Modified Springlock MODsuit Module
|
|2
|0
|Модуль, занимающий весь размер МОД-костюма и расположенный под внешней обшивкой. Этот механический экзоскелет ускоряет разворачивание костюма, но его убрали из современных МОДов из-за склонности замка «защелкиваться» обратно на место при воздействии влаги. Ты знаешь, каково это, когда экзоскелет сминает тебя? Полезно для быстрого снятия/надевания МОДа или подстраивания несчастного случая.
|
|-
| id="Australicus_Slime_Mutator" |Australicus Slime Mutator
|[[file:Syringe.png]]
| style="text-align: center;" |[[file:roboticist.png]] [[Roboticist]], [[file:Scientist_generic.png]] [[Scientist]]
| style="text-align: center;" |10
|300
|Требует знаний [[Guide_to_xenobiology|ксенобиологии]] для правильного использования. Покупая это, вы получаете шприц, содержащий 1 юнит Spider Extract. Когда это вещество вводится в неиспользованный [[Guide_to_xenobiology#Gold_Slime|экстракт золотого слайма]] создает три невраждебных и пассивных [[Spider#Uncommon_Spiders|паука-матери]]. Они не причинят никакого вреда, если только вам не удастся сделать их разумными, дав зелье разума [[Guide_to_xenobiology#Light_Pink_Slime|экстракта светло-розового слайма]] (в комплект не входит).
|
|-
| id="Reagent_Dartgun" |Reagent Dartgun
|[[file:Regeantdartgun.png]]
| style="text-align: center;" |[[file:chemist.png]] [[Chemist]], [[file:Generic_cmo.png]] [[Chief Medical Officer|CMO]], [[file:botanist.png]] [[Botanist]]
| style="text-align: center;" |12
|200
|Особый дротикомет производящий 4 ''пробивных'' шприца, вмещающих по 15 юнитов веществ, каждые 25 секунд заполняя их из внутреннего хранилища на 100 юнитов. Наполнять его придется вручную.
|
|-
| id="Brainwashing_Surgery_Program" |Brainwashing Surgery Program
|[[file:Disk.gif]]
| style="text-align: center;" |[[file:MedicalDoctor.png]] [[Medical Doctor]], [[file:Generic_cmo.png]] [[Chief Medical Officer|CMO]], [[file:roboticist.png]] [[Roboticist]]
| style="text-align: center;" |5
|0
| Диск, содержащий процедуру проведения операции по «промыванию мозгов», позволяющую имплантировать основной цели задачу, которой она должна подчиняться. Вставьте в операционную консоль, чтобы активировать процедуру.
|
|-
|Syndicate Brand MMI
|
|[[file:MedicalDoctor.png]] [[Medical Doctor]], [[file:Generic_cmo.png]] [[Chief Medical Officer|CMO]], [[file:roboticist.png]] [[Roboticist]]
[[file:Scientist_generic.png]] [[Scientist]]

[[Research Director|RD]]
|2
|0
|MMI, модифицированный так, чтобы дать киборгам законы Синдиката без повреждения их интерфейса ЕМАГом. Это не разблокирует их скрытые модули.
|
|-
| id="Kinetic_Accelerator_Pressure_Mod" |Kinetic Accelerator Pressure Mod
|[[file:modkit.png]]
| style="text-align: center;" |[[file:miner.png]] [[Miner]]
| style="text-align: center;" |5
|300
|Модификация для кинетического акселератора, увеличивающая его эффективность в средах с нормальным давлением. Занимает 35% вместимости КА. Необходимо два для полного урона. (К покупке доступны 2 модуля).
|
|-
| id="Explosive_Hot_Potato" |Explosive Hot Potato
|[[file:potato.png]]
| style="text-align: center;" |[[file:botanist.png]] [[Botanist]], [[file:Generic chef.png]] [[Cook]], [[file:clown.png]] [[Clown]], [[file:mime.png]] [[Mime]]
| style="text-align: center;" |4
|0
|При использовании в руках срабатывает специальный механизм, предотвращающий его падение и запускающий таймер. Передать картошку другому можно лишь ударив его, когда отсчёт завершится она взорвется!
|
|-
|Combat Bakery Kit
|
| style="text-align: center;" | [[file:Generic chef.png]] [[Cook]], [[file:mime.png]] [[Mime]]
|7
|150
|Набор секретного хрустящего оружия. Содержит багет, который опытный мим может использовать в качестве меча, пару метательных круассанов и рецепт их приготовления. Как только работа будет выполнена, съешьте улики.
|
|-
| id="Meat_Hook" |Butcher's Meat Hook
|[[File:Meat_hook.png]]
| style="text-align: center;" |[[file:Generic chef.png]] [[Cook]]
| style="text-align: center;" |11
|0
|Мясницкий крюк на длинной цепи. Вы можете выпустить цепь вдаль притягивая к себе цель, нанося 20 грубого урона и столько же по выносливости с пробитием брони 60 и 0.5 секундым [[Status_Effects#Knockdown|нокдауном]].
|
|-
| id="Disposable Sentry Gun" |Disposable Sentry Gun
|[[File:Turret.PNG]]
| rowspan="2" style="text-align: center;" |[[file:Generic_engineer.png]] [[Station Engineer]]
| style="text-align: center;" |11
|0
|Одноразовая система развертывания турели, хитро замаскированная под ящик для инструментов. Работает и функционирует как обычный красный тулбокс, пока вы не атакуете его {{Combat_Mode}} боевым гаечным ключом, идущим в комплекте. После этого на месте тулбокса развернется турель, стреляющая по всем, кроме вас. У нее всего 100 здоровья, так что сломать её довольно просто.
|
|-
|Syndicate Rebar Crossbow
|[[File:Syndiexbow.png|left|frameless|32x32px]]
|10
|0
|Более профессиональная версия инженерского [[Makeshift weapons#Heated rebar crossbow|арматурного арбалета]]. Магазин на 3 болта, быстрая зарядка, встроенный прицел, лучшие боеприпасы, не взрывается вам прямо в лицо. Руководство пользователя включено.
|Наносит 35 урона с большим шансом встрять в теле и нанести травму, но скорострельность не очень высокая. Хорош для убийства незащищенной цели, но ужасен в долгой драке.
|-
| id="Occupational_Corruption_Device" |Organic Resources Disturbance Inducer
|[[File:Occupational_corruption_device.png]]
| style="text-align: center;" |[[file:Generic_hop.png]] [[HoP]], [[file:Generic_qm.png]] [[QM]]
| style="text-align: center;" |2
|0
|Устройство профессиональной коррупции. Его использование вызывает событие бюрократической ошибки, которое случайным образом открывает и закрывает доступные вакансии для опоздавших. Купить можно лишь один раз.
|
|-
|GLA Brand Mail Counterfeit Kit
|
|QM,
Cargo

tech
|2
|0
|Коробка полная mail counterfeit devices. Устройства способные подделывать почту НТ. Эти устройства также способны размещать в почте ловушку. Она «активирует» любой предмет внутри почты. Также поддельная почта может использоваться в контрабандных целях. Встроенный микрокомпьютер предоставит вам множество возможностей для конфигурации.

Nothing stops the mail.
|Используйте с бомбами.
|}

===(Pointless) Badassery===
'''All items available to nuclear operatives.'''
{|class="wikitable sortable"
!Item
!class="unsortable"|Icon
!Cost
!Threat Requirement
!class="unsortable"|description
!class="unsortable"|info
|-
|id="Syndicate_Playing_Cards"|Syndicate Playing Cards
|[[file:Syndi_cards.png]]
|style="text-align: center;"|1
|0
|Специальная колода игральных карт с мономолекулярной кромкой и металлическим усилением, что делает их смертоносным оружием как при использовании в качестве оружия ближнего боя, так и при броске. Также ими можно играть в карточные игры.
|
|-
|id="Syndicate_Briefcase_Full_of_Cash"|Syndicate Briefcase Full of Cash
|[[file:Briefcase.png]]
|style="text-align: center;"|3
|50
|Чемодан, защищённый кодовым замком, набит 5000 кредитами. В теории полезен для подкупа и закупки предметов. Довольно тяжелый, так что можно использовать как оружие, если переговоры пройдут не по плану.
|
|-
|id="Syndicate_Smokes"|Syndicate Smokes
|[[file:Syngarettes.png]]
|style="text-align: center;"|2
|0
|Крепкий вкус с густым дымком. Содержит 10 юнитов [[Guide_to_chemistry#Nicotine|никотина]] и 15 [[Guide_to_chemistry#Omnizine|омнизина]]. Одна сигарета выкуривается примерно за 2 минуты.
|
|-
|id="Syndicate_Balloon"|Syndicate Balloon
|[[file:Balloon.png]]
|style="text-align: center;"|20
|0
| Это просто шарик с буквой S. Висит в воздухе и наполнен гелием. Легкий способ взбесить валидхантеров.
|Не позволит купить в аплинке другие предметы.
|-
|id="Broken_Chameleon_Kit"|Broken Chameleon Kit
|[[file:Syndibox.png]][[file:Changeling.gif]]
|style="text-align: center;"|4
|900
|Полный хамелеон-набор, не содержащий только оружие, однако работает как сломанный при помощи ЭМИ. Мигает как новогодняя ёлка, так что вы будете сильно выделяться.
|
|-
|id="Centcom_Official_Costume"|Centcom Official Costume
|[[file:Syndibox.png]][[file:centcomcommander.png]]
|style="text-align: center;"|20
|1100
|Содержит полный комплект униформы Центрального Командования, гарнитуру и планшет. Гарнитура поставляется без ключа шифрования.
|
|-
|id="Clown_Costume"|Clown Costume
|[[file:Clownduffle.png]][[file:Generic_clown.png]]
|style="text-align: center;"|4
|700
|Содержит полный набор [[Clown|клоуна]].
|
|-
|id="Tactical_Naptime" id="Sleepy_Time_Pajama_Bundle"|Sleepy Time Pajama Bundle
|[[file:Syndibox.png]][[File:Syndi_pajama.png]]
|style="text-align: center;"|4
|900
|Даже солдатам нужен хороший отдых. В комплекте идет кроваво-красная пижама, одеялко, горячая кружка какао и пушистый друг.
|
|-
|Syndicate Sticker Pack
|[[File:Syndibox.png]]
|1
|0
|Содержит 8 случайных стикеров, имитирующих всяческие подозрительные предметы. Можно попробовать обмануть кого-нибудь.
|
|}

=Nuclear Operatives special equipment=
Below are items available exclusively to [[Nuclear Operative]]s.
==Ваш аплинк==
{|
|[[File:generic_nukesyndie.png]]
|Ядерные оперативники имеют аплинк в виде радио [[file:radio.png]] который всегда '''открыт''', может быть использован в крайнем случае как взрывчатка если у вас закончились Телекристалы. Меню закупки разделено по категориям. Оперативники в начале раунда получают 30 телекристалов, и могут получить больше если объявят войну Нанотрайзен.
|}
Некоторые предметы настолько дорогие что иногда вам может не хватить телекристалов что бы их купить. Вы можете получить больше телекристалов от других оперативников или отдать им свои. Как? В категории "bundles and telecrystals" вы можете "Купить" телекристалы, что бы извлечь их из вашего аплинка и вставить их в любой другой открытый аплинк.

У каждого оперативника может быть до 3 предметов со случайной скидкой. Дешёвые предметы имеют больший шанс на получение скидки и скидки в среднем ровняются 50%, но в любом случае у вас есть шанс сорвать джекпот и получить револьвер со скидкой 80%. Также есть скидки команды: предметы со скидкой не имеют ограничения по покупке (вы можете покупать их столько, сколько хотите, лишь бы телекристалов хватало) и доступны каждому оперативнику. И спаси вас господь если у оперативников будут скидки на взрывчатку, штурмовых киборгов или мехов.

===Bundles===
{|class="wikitable sortable"
!Item
!class="unsortable"|Icon
!Cost
!class="unsortable"|description
!class="unsortable"|info
|-
|id="Cybernetic_Implant_Bundle"|Cybernetic Implant Bundle
|[[file:Duffle_syndiemed.png]]
|style="text-align: center;"|40
|Содержит 5 случайных кибер-имплантов. Гарантированно окупает свою стоимость.
|С самым дорогим имплантом макробомба за 20 ТК, максимальная экономия будет около 60% и в среднем ниже. Стоит проверить другие категории скидок перед покупкой.
|-
|id="Medical_bundle"|Medical bundle
|[[file:Duffle_syndiemed.png]]
|style="text-align: center;"|15
|Специалист по поддержке : Помогайте своим товарищам по команде с этим медицинским набором. Внутри вы найдете: боевую медицинскую аптечку с бинтами, компактный дефибриллятор, пластыри от ушибов/ожогов, шприц с [[Guide_to_chemistry#Chloral_Hydrate|Хлоралгидратом]], и боевой гипоспрей вмещающий в себя:
*30 юнитов [[Guide_to_chemistry#Epinephrine|Эпинефрина]]
*30 юнитов [[Guide_to_chemistry#Omnizine|Омнизина]]
*15 юнитов [[Guide_to_chemistry#Leporazine|Лепоразина]]
*15 юнитов [[Guide_to_chemistry#Atropine|Атропина]]
Также включает HUD очки ночного виденья/здоровья, пулемет Donksoft, коробку с боеприпасами и магбутсы для спасения союзников в состояние невесомости.
|Спасенные 5 ТК.
|-
|id="Spetsnaz_Pyro_bundle"|Spetsnaz Pyro bundle
|[[file:Duffle_syndie.png]]
|style="text-align: center;"|30
|Для систематического подавления углеродных форм жизни на ближней дистанции: Содержит в себе [[#Elite Syndicate Hardsuit|элитный мод-костюм синдиката]], a вместе а вместе с ним пиро-ранцевый распылитель, [[#Stechkin APS|Пистолет Стечкина]], два увеличенных магазина, бутылка водки, a [[#Syndicate Minibomb|самодельную бомбу]], and a [[#Stimpack|Стимулятивный медипен]] .
|Сохранит 12 ТК. Рюкзак-распылитель, если честно, так себе. Ради всего святого, '''не подожгите своих напарников!!'''
|-
|Syndicate Induction Kit
|[[file:Syndibox.png]]
|10
|Необычная часть снаряжения, этот набор имеет базовый комплект ядерного оперативника, но что более важно имеет имплант вербовки, который легитимно "вербует" любого валидного антаганиста в команду ядерных оперативников.
Содержит:

* One Ansem pistol
* One 10mm AP magazine
* One 10mm HP magazine
* Energy Dagger
* Syndicate Headset
* Nuclear PDA
* Agent Card
* Space Suit and Helmet
* Jet Harness
* Induction Implant
|Общая цена в наборе ~25 ТК, но в любом случае это базовый набор оперативника который они получают со старта.

Обычные члены экипажа не могут быть завербованы, а ОБР тем более. Тем не менее, вы можете завербовать любых других антагонистов, включая предателей, генокрадов, еретиков и даже загипнотизированных людей!
|}

===Weapons and Weapon Kits===
'''Note:''' Большинство оружий идут как наборы, в которых будет оружие и доп. магазины. Доступные боеприпасы были выведены в таблицу оружия для показа эффективности.
{| class="wikitable sortable"
!Item
! class="unsortable" |Icon
!Cost
! class="unsortable" |description
! class="unsortable" |info
|-
| id="Bulldog_Shotgun" |Bulldog Shotgun
|[[File:Nukeop case.png]]
[[file:Bulldog.png]]
| style="text-align: center;" |8
|Бульдог это полу-автоматический барабанный дробовик на 8 патронов. Он может быть отличным оружием отступления или робастным основным оружием. Несмотря на то что он страдает от недостатков дробовиков (урон зависит от дальности) он может стать доступной альтернативой на смену другим дорогим оружием. Имеет ударник синдиката, который не позволяет врагам использовать оружие.

Набор включает в себя дробовик Бульдог и 3 запасных стандартных магазина (4, если считать заряженный магазин).
{| class="mw-collapsible mw-collapsed" style="width:100%"
! class="unsortable" |icon
! class="unsortable" |Название
! class="unsortable" |ammo types
!cost
|-
|[[file:BuckshotBull.png]]
| id="12g_Buckshot_Drum" |12g Buckshot Drum
| A 8 round drum magazine for use in the Bulldog Shotgun. Essentially functions as any normal shotgun, deals great damage in close range combat, dealing 45 brute damage if all pellets hit, but has damage falloff over range. Akin to most shotguns a buckshot magazine is unreliable in ranged combat, however this ammo type excels in close range encounters such as maintenance or when holding a corner.
| style="text-align: center;" | 2
|-
|[[file:DragonBreathBull.png]]
| id="12g_Dragons_Breath_Drum" |12g Dragon's Breath Drum
|A 8 round drum magazine for use in the Bulldog Shotgun. Dragon's Breath shells trade immediate damage, dealing only 20 brute damage if all pellets hit a target, for long term damage in setting anyone caught in its blast on fire. A shot from a Dragon's Breath magazine leaves a long trail of fire that quickly dissipates, but can be effective in setting many crew members on fire. Don't shoot your own teammates in the back.
| style="text-align: center;" |2
|-
|[[file:BreachingBull.png]]
| id="12g_Breaching_Drum" |12g Meteorslug
|A 8 round drum magazine for use in the Bulldog Shotgun. Meteor Slugs shoot one single 30 damage meteor, that stuns any person it hits for a moment. The real value of these shells is that anything hit by them is knocked away or dealt massive damage. This lets you instantly destroy walls and windows, as well as breaching airlocks, leaving their frame vulnerable and locked.
| style="text-align: center;" |2
|-
|[[file:BuckshotBull.png]]
| id="12g_Slug_Drum" |12g Slugs
|A 8 round drum magazine for use in the Bulldog Shotgun. Shoots one single 50-damage projectile.
| style="text-align: center;" | 3
|}
|
|-
| id="C-20r_Submachine_Gun" |C-20r Submachine Gun
|[[File:Nukeop case.png]]
[[file:C20r.png]]
| style="text-align: center;" |14
|Имеет магазин на 24 патрона .45 калибра. Надёжное и робастное оружие. Может быть оснащён [[#Universal_Suppressor|Silencer]] глушителем. Имеет ударник синдиката, который не позволяет врагам использовать оружие.

Идёт в наборе с 3 доп. магазинами.
{| class="mw-collapsible mw-collapsed" style="width:100%"
! class="unsortable" |icon
! class="unsortable" |Название
! class="unsortable" |ammo types
!cost
|-
|[[file:45Mag.png]]
| id=".45_Ammo_Magazine" |.45 Ammo
|A 24-round .45 magazine for use in the [[#C-20r_Submachine_Gun|C-20r submachine gun]]. 35 raw damage.
| style="text-align: center;" |2
|-
|[[file:45Mag.png]]
|.45 Incendiary SMG Magazine
|A 24-round .45 magazine for use in the [[#C-20r_Submachine_Gun|C-20r submachine gun]]. 15 raw damage, adds two firestacks.
| style="text-align: center;" |4
|-
|[[file:45Mag.png]]
|.45 Armor Piercing SMG Magazine
| A 24-round .45 magazine for use in the [[#C-20r_Submachine_Gun|C-20r submachine gun]]. 30 raw damage, 50 Armor Piercing capability.
| style="text-align: center;" |4
|-
|[[file:45Mag.png]]
| .45 Hollow Point SMG Magazine
|A 24-round .45 magazine for use in the [[#C-20r_Submachine_Gun|C-20r submachine gun]]. It deals a whooping 50 raw damage, though it falls substantially when armor comes into play.
| style="text-align: center;" |4
|}
|
|-
| id="SAW" |L6 Squad Automatic Weapon Case
|[[file:L6machinegun.png]]
| style="text-align: center;" | 18
|Вмещает больше всего патронов из всего оружия: 50 патронов, калибра 7мм. наносящий высокий урон травмами. Пара точных выстрелов и им хана. Стреляет очередью из 3 выстрелов и требует 2-ух рук для стрельбы. Что бы достать магазин нужно открыть крышку ствольной коробки Alt-Кликом. Имеет ударник синдиката, который не позволяет врагам использовать оружие.

Идёт одним оружием без дополнительных магазинов.
{| class="mw-collapsible mw-collapsed" style="width:100%"
! class="unsortable" |icon
! class="unsortable" |Название
! class="unsortable" | ammo types
!cost
|-
|[[file:A762.png]]
|7mm Box Magazine
|A 50-round magazine of 7mm ammunition for use in the [[#L6 SAW|L6 SAW]] machinegun. By the time you need to use this, you'll already be on a pile of corpses.
| style="text-align: center;" | 2
|-
|[[file:A762.png]]
|7mm (Hollow-Point) Box Magazine
|A 50-round magazine of 7mm Hollow-Point ammunition, that deals 60 damage on hit, that is however heavily reduced by armor.
| style="text-align: center;" | 4
|-
|[[file:A762.png]]
|7mm (Incendiary) Box Magazine
|A 50-round magazine of 7mm Incendiary ammunition, that only deals 20 damage on hit but leaves a fiery trail, while setting targets hit on fire as well.
| style="text-align: center;" |3
|-
|[[file:A762.png]]
|7mm (Armor Penetrating) Box Magazine
|A 50-round magazine of 7mm Armor Penetrating ammunition, that deals 40 damage on hit and negates all but the most durable armor.
| style="text-align: center;" |4
|-
|[[file:A762.png]]
|7mm (Match) Box Magazine
|A 50-round magazine of 7.12x82mm ammunition for use in the L6 SAW. Perfect for ricocheting off walls all fancy-like. 40 damage, 60 ricochet chance.
| style="text-align: center;" |5
|}
|
|-
| id="Sniper_Rifle" | Sniper Rifle
|[[File:Nukeop case.png]]
[[file:Sniper.png]]
| style="text-align: center;" |18
|Снайперская винтовка мощная дальнобойная оружие оснащённая оптикой; активация прицела сдвинет твой экран вперёд позволяя видеть дальше чем обычно, позволяет тебе стрелять по ничего не подозревающим целям. Требует 2-е руки для стрельбы. Изначально заряжено 6 патронами, калибра .50 BMG которые нанесёт 70 урона, оглушает, пробивает броню, и имеют шанс на отрубания конечностей. Они также наносят значительный урон постройкам, уничтожает воздушные шлюзы и машины с 1-2 выстрелов. Имеет ударник синдиката, который не позволяет врагам использовать оружие.

Идёт в наборе с 3 доп. магазинами; 2 стандартные, 1 усыпляющие, вместе с костюмом (который имеет одинаковые характеристики с твоим начальным тактическим свитером), галстуком, ручкой и папкой.
{| class="mw-collapsible mw-collapsed" style="width:100%"
! class="unsortable" |icon
! class="unsortable" |Название
! class="unsortable" |ammo types
!cost
|-
|[[file:Sniper_ammo.png]]
| id=".50_Magazine" |.50 Magazine
|A 6-round magazine of .50 ammunition for the sniper rifle. Deals 70 damage, stuns, penetrates armor and destroys machinery on hit.
| style="text-align: center;" |2
|-
|[[File:Penetrator.png|frameless]]
| id=".50_Penetrator_Magazine" |.50 Penetrator Magazine
|A 6-round magazine of .50 penetrating ammunition for the sniper rifle. Deals 60 damage, doesn't stun, dismember or break machinery. But it passes through everything it hits, including walls, making it extremely useful for crowds or very protected targets, like the AI.
| style="text-align: center;" |4
|-
|[[file:Sniper_ammo_sleep.png]]
| id=".50_Soporific_Magazine" | .50 Disruptor Magazine
|A 6-round magazine of .50 disruptor ammunition for the sniper rifle. Deals almost no damage and doesn't break machinery, but any human hit by these will fall asleep for about 40 seconds, and an EMP will trigger around the impact point.
| style="text-align: center;" |2
|-
|[[file:Sniper_ammo_blood.png]]
|.50 Marksman Magazine
|A 6-round magazine of .50 marksman ammunition for the sniper rifle. It's hitscan with one guaranteed ricochet, deals 50 damage, penetrates armor, and stuns if they aren't wearing armor.
| style="text-align: center;" |5
|-
|
|.50 Incendiary Magazine
|A 6-round magazine of .50 incendiary ammunition for the sniper rifle. It deals 70 fire damage instead of brute, and unleashes a large fireball around the point of impact, making it more suited for crowd control.
|3
|-
|
|.50 Surplus Magazine Box
|A box with 7 surplus magazines inside. These are slightly worse than normal mags, lacking some of its penetrating power and the stun, but they are 50% cheaper, which can be handy when you're in need of a large amount of bullets.
|7
|}
|
|-
| id="Surplus_SMG" |Surplus SMG
|[[file:Plastikov.png]]
| style="text-align: center;" | 2
|Древний ПП калибра 9х19мм. чертёж которого был улучшен и упрощён для снижения стоимости, но видимо был упрощён слишком сильно...

Идёт одно оружие без доп. магазинов.
{| class="mw-collapsible mw-collapsed" style="width:100%"
! class="unsortable" |icon
! class="unsortable" |Название
! class="unsortable" |ammo types
!cost
|-
|[[file:9x19full_ammo.png]]
|Surplus SMG Magazine
|50 shots. 10 damage each.
| style="text-align: center;" |1
|}
|Substituted the mosin. A more forgiving weapon for shoot-ers and shoot-ats.
|-
| id="Stechkin_APS_Machine_Pistol" |Ansem Pistol
|[[File:Nukeop case.png]]
[[file:Stetchkin.png]]
| style="text-align: center;" |8
|Полуавтоматический пистолет синдиката калибра 10мм. использует 10мм. патроны в 8 зарядных магазинах и может быть оснащён глушителем.

Идёт в наборе с 3 магазинами для Ансема.
{| class="mw-collapsible mw-collapsed" style="width:100%"
! class="unsortable" |icon
! class="unsortable" |Название
! class="unsortable" |ammo types
! cost
|-
|[[file:9mmaps.png]]
| id="Stechkin_Magazine" |10mm Ansem Magazine
|An additional 8-round 10mm magazine, compatible with the Ansem pistol. 40 raw BRUTE damage.
| style="text-align: center;" |2
|-
|[[file:9mmaps.png]]
|10mm Ansem Incendiary Magazine
|An 8-round magazine full of incendiary bullets that deal 20 BRUTE damage, set the target aflame, and leave a trail of fire in their path.
|3
|-
|[[file:9mmaps.png]]
|10mm Ansem Armor Piercing Magazine
|An 8-round magazine for the Ansem pistol. Armor piercing bullets deal 35 BRUTE damage, but go through most armor types
|4
|-
|[[file:9mmaps.png]]
|10mm Ansem Hollow Point Magazine
|An 8-round magazine for the Ansem pistol. Hollow points deal 50 raw BRUTE damage, though they are easily stopped by any armor the target may be wearing.
|4
|}
Важно подметить что этот пистолет у тебя есть со старта на поясе, но поэтому покупать отдельные магазины будет выгодней чем покупать весь набор.
|
|-
| id="M-90gl_Carbine" |M-90gl Carbine
|[[File:Nukeop case.png]]
[[file:M90.png]]
| style="text-align: center;" |14
|Этот карабин имеет очередь из 3 выстрелов вместе с подствольным гранатомётом. Магазины вмещают 30 патронов, которых более чем достаточно против не бронированных целей.

В наборе идут 2 доп. магазинами и коробкой из 4-ёх резиновых гранат для гранатомёта.
{| class="mw-collapsible mw-collapsed" style="width:100%"
! class="unsortable" |icon
! class="unsortable" |Название
! class="unsortable" |ammo types
!cost
|-
|[[file:5.56m_toploader_mag.png]]
|5.56mm Toploader Magazine
| An additional 30-round 5.56mm magazine;. Every time you call it a clip, god, kills a kitten. 35 damage, 30 AP.
| style="text-align: center;" |4
|-
|[[file:5.56m_toploader_mag.png]]
|5.56mm Toploader Phasic Magazine
|An additional 30-round 5.56mm magazine; These bullets are made from an experimental alloy, 'Ghost Lead', that allows it to pass through almost any non-organic material. 20 damage, 70 AP.
| style="text-align: center;" |8
|-
|[[file:40mmHE_ammo.png]]
|40mm HE Grenade Box
|A box of four 40mm HE grenades for use with the M-90gl's under-barrel grenade launcher. Insert into the M-90gl Carbine. Do not throw. These grenades do not fit in regular grenade launchers.
| style="text-align: center;" |2
|-
|[[file:40mmHE_ammo.png]]
|40mm Rubber Slug Grenade Box
|A box of four 40mm rubber-tipped grenades for use with the M-90gl's underbarrel launcher. Instead of the typical explosion, these will knock down the target, dealing 120 stamina damage and 20 BRUTE. The only way to acquire these is from the free box that comes with the kit.
|N/A
|}
{{Leftclick}} Primary fire. 
{{Rightclick}} Grenade launcher.
|
|-
| id="84mm_Rocket_Propelled_Grenade_Launcher" |84mm Rocket Propelled Grenade Launcher
|[[File:Nukeop case.png]]
[[File:Dardo RL.png]]
| style="text-align: center;" |8
|A reusable rocket propelled grenade launcher preloaded with a low-yield 84mm HE round.

The case comes with a bouquet of three aditional HE rockets.
{| class="mw-collapsible mw-collapsed" style="width:100%"
! class="unsortable" |icon
! class="unsortable" |Название
! class="unsortable" |ammo types
!cost
|-
|[[File:RL ammo.png]]
|84mm HE Rocket
|A bouquet of three low-yield anti-personnel HE rocket.
| style="text-align: center;" |2
|-
|[[File:HEAP ammo.png]]
| 84mm HEAP Rocket
|A high-yield HEAP rocket; extremely effective against armored targets (mechs and silicons), as well as surrounding personnel.
| style="text-align: center;" |4
|}
'''Note:''' HE rockets are bought in bundles of three for 2 TC, and the HEAP ones are bought a single one at a time. Keep that in mind when bulk buying ammo for the launcher.
|
|-
|Syndicate Revolver kit
|[[File:Nukeop case.png]]
|14
|Набор содержащий знаменитый револьвер синдиката который могут купить предатели, с 3 дополнительными обоймами калибра .357 и несколькими типами боеприпасов доступных для покупки.
{| class="mw-collapsible mw-collapsed" style="width:100%"
|+
!Icon
!Название
!Ammo Types
!Cost
|-
|[[file:357_speedloader.png]]
|.357 Speedloader
|Standard .357 ammunition, deals 60 damage per shot. Exactly the same one traitors use.
|2
|-
|[[file:357_speedloader.png]]
|.357 Phasic Speedloader
|Specialized .357 ammunition that only deals 35 BRUTE damage per shot, however, the main advantage of these bullets is their ability to go unphased through walls and armor, ensuring a plain 35 BRUTE on every hit.
|5
|-
|[[file:357_speedloader.png]]
|.357 Heartseeker Speedloader
|Specialized .357 ammunition that deals 50 BRUTE per shot, but homes in towards targets, making it better suited for longer ranges.
|3
|}
|
|-
|Energy Shield/Sword Case
|[[file:Eshield.png]]
[[File:Nukeop case.png]]
|14
|A melee focused weapon kit that contains an energy sword, an energy shield, and a (fake) medieval helmet.
Takes more skill to use, but the high deflection chance of the energy shield and sword combined can be devastating if the crew is using lasers to fight you.

Alternatively, you can buy the energy sword as a standalone item for 8TC under the "conspicuous weapons" section.
|
|-
|Double-Bladed Energy Sword Case
|[[File:Nukeop case.png]]
|18
|An even more melee focused weapon kit, that includes a double-bladed energy sword, an anti-slip module for your MODsuit, a meth autoinjector and a bar of Syndicate soap. If your team ends up buying the chemical plant keycard, you might be interested in concocting something to counteract the meth's innate brain damage, or buy a stimpack if you don't want to bother with chemistry.
There's also a prisoner jumpsuit on the case, though it lacks the protection of the turtleneck you start with.
|
|-
|CQC Case
|[[File:Nukeop case.png]]
[[file:CQC_manual.png]]
|14
|This kit contains a CQC manual that will train you in such martial art. Upon reading this one-use book, you'll learn how to perform devastating melee combos by chaining a series of actions, as displayed in the following table:
{| class="mw-collapsible mw-collapsed" style="width:100%" border="1" cellspacing="0" cellpadding="2"
! scope="col" style="background-color:#FA8778;" |Combo name
! scope="col" style="width:240px; background-color:#FA8778;" |Combo
! scope="col" style="background-color:#FA8778;" |Effect
|-
|'''Slam'''
|{{Grab}} {{Harm}}
|Slam opponent into the ground (10 brute and 12 sec paralyze). Only works on people standing.
|-
|'''CQC Kick'''
|{{Harm}} {{Harm}}
|If the target is lying down, deals 10 brute and 45 stamina damage. If the target is in stamcrit while down, deals a 10 sec knockout. Kicks also knock the target back one tile.
|-
|'''Restrain'''
|{{Grab}} {{Grab}}
| Locks opponent into a restraining position (10 sec stun, 20 stamina damage). Disarm while restraining and pulling to knock them out with a choke hold (40 sec sleep).
|-
|'''Pressure'''
|{{Disarm}} {{Grab}}
|Deals 60 stamina damage.
|-
|'''Consecutive CQC'''
|{{Disarm}} {{Disarm}} {{Harm}}
| Mainly a damaging move (25 brute and 50 stamina damage).
|}
CQC will also make all your grabs start as agressive, and your punches deal more damage.

On top of that, the case also contains a bandana, some omnizine cigarettes, and a stealth implant.
|
|-
| id="Flamethrower" | Flamethrower (*)
|[[file:Flamethrower.png]]
| style="text-align: center;" |15
|Shoots jets of burning plasma. Has little stopping power, but will usually cause enemies to retreat. Can be reloaded by using plasma tanks or canisters in [[Toxins]] or [[Engineering]]. '''Remember only the black MODsuits are fireproof.'''

Can be found in the base ordnance laboratory.
|Identical to a craftable flamethrower.
|-
| id="Biohazardous_Chemical_Sprayer" | Biohazardous Chemical Sprayer (*)
|[[file:Bio_chem_sprayer.png]]
| style="text-align: center;" |15
|A high-volume chemical sprayer loaded with the most lethal poisons available to the syndicate; anyone caught by the spray will die a quick and painful death if not treated immediately or wearing protective clothing.

Found in the base bio-weapon laboratory.
|Due to the way sprayers distribute chems, and the fact that this is loaded with SIX different poisons (Initropidril, Venom, Polonium, Coniine, Sodium Thiopental, and Condensed Capascin,) this is almost entirely useless in its current state unless you spray someone several times on the 10u setting at point blank.
|}
(*) This item can be found in one of the syndicate base laboratories, and cannot bought in the uplink. The cost is shown as that of the required key.

=== Base keys ===
'''Note:''' There are several locked rooms in the Syndicate base. These can only be accessed via special keycards, bought in the uplink. Only one operative needs to buy a key for the whole team to be able to access the laboratory, and buying more than one copy of each keycard is a waste of TC
{| class="wikitable sortable"
|+
!Item
!Icon
!Cost
!Description
|-
|Syndicate Ordnance Laboratory Access Card
|[[File:Syndicate labkey.png]]
|15
|Grants access to the Ordnance Laboratory, where you'll find gas canisters, tank transfer valves, and other equipment to let you make gas-based explosives. using this item effectively will need you to know enough [[Guide to Ordnance|ordnance]], so your bombs will be effective. On top of that, you get a flamethrower and powerfist for free, which can be found on the lab.
|-
|Syndicate Bio-Weapon Laboratory Access Card
|[[File:Syndicate labkey.png]]
|15
|Grants access to the Bio-Weapon Laboratory, which has a small slime pen, hydroponics trays and a PanD.E.M.I.C, as well as enough gear to let you use these machines to your advantage as you see fit. This does mean that you have to know your way around [[Guide to hydroponics|botany]], [[Guide to virology|virology]] or [[Guide to xenobiology|xenobiology]] to make effective use of this laboratory. A fully loaded Bioterror Spray is available at the lab for free as well, if you plan on using it.
|-
|Syndicate Chemical Plant Access Card
|[[File:Syndicate labkey.png]]
|15
|Grants access to the Chemical Plant, that lets you make an extensive range of chemicals to aid in your operation. This can range from incredibly deadly weapons to powerful combat medication, though you'll need to know proper [[Guide to chemistry|chemistry]] to make the most out of this purchase. Inside the laboratory, you'll find an emagged, upgraded chemical dispenser and a plumbing constructor, as well as your typical chemist equipment. On top of that, there's a dart pistol availabe for free inside the plant.
|-
|Lopez's Access Card
|[[File:Lopez's keycard.png]]
|5
|Grants access to a small freezer found in the bar, where you can find a large amount of food and ingredients for whatever dish you want to make. A good read to the [[guide to food]] can give you some ideas if that's what you're going for.
|}

===Grenades and Explosives===
{| class="wikitable sortable"
! Item
! class="unsortable" |Icon
!Cost
! class="unsortable" |description
! class="unsortable" |info
|-
| id="Bioterror_Foam_Grenade" |Bioterror Foam Grenade
|[[file:Grenade.png]]
| style="text-align: center;" | 5
|A powerful chemical foam grenade which creates a deadly torrent of foam that will mute, blind, confuse, mutate, and irritate carbon lifeforms. Specially brewed by Tiger Cooperative chemical weapons specialists using additional spore toxin. Ensure suit is sealed before use.
|
|-
| id="Buzzkill_Grenade_Box" |Buzzkill Grenade Box
|[[file:Syndibox.png]]
| style="text-align: center;" |15
|These grenades release ten bees that will indiscriminately attack anyone with random toxins. Keep in mind that bees can't attack people wearing thick clothing - like hardsuits and EVA/fire/bio/EOD suits as well as some costumes.
|
|-
| id="Fungal_Tubercolosis_Grenade" | Fungal Tuberculosis Grenade
|[[file:box.png]]
| style="text-align: center;" |12
| A box that contains several ways to apply the Fungal Tuberculosis virus: an extremely virulent and hard to cure disease that stuns and suffocates its targets. The box contains a viral smoke grenade, 5 single-use instant Bio Virus Antidote Kits (BVAK autoinjectors) with 20u vaccine (inject 10u per use), a BVAK bottle (30u vaccine) and a normal syringe.
|
|-
| id="Viscerator_Delivery_Grenade" |Viscerator Delivery Grenade
|[[file:Delivery_grenade.png]]
| style="text-align: center;" |5
|This grenade, when thrown, will disperse 10 manhack viscerators. They will proceed to chase and attack any nearby Non-Syndicate personnel. They deal a surprisingly high amount of damage over time but can be outrun easily. The grenade is fantastic at helping clearing out a crowd of crewmen. However, it can be ineffective against Security personnel and the Captain as their armor and weapons allow them to ignore the viscerators long enough to (try to) gun you down. They are also extremely sharp and can outright sever limbs when attacking.
|Bought in three unit boxes for 15TC
|-
| id="Grenadiers_Belt" |Grenadier's Belt
|[[file:Combat_belt.png]]
| style="text-align: center;" |22
|A belt containing a large amount of assorted grenades. TO be specific, it contains:
* 2 [[#Syndicate_Minibomb|Syndicate Minibombs]];
*10 Frag Grenades: A bit less powerful than minibombs, but with a higher flame range;
*2 Incendiary Grenades: They spread a wave of plasmafire, burning everything in their path;
*4 Gluon Grenades: They deal radiation damage when exploding, and freeze the surrounding area afterwards, making it slippery;
* 2 EMP Grenades;
*1 [[Guide_to_chemistry#Fluorosulfuric_Acid|Fluorosulfuric Acid]] Smoke Grenade: It will spread extremely potent acid in its area of effect, melting armor, objects and people inside;
*1 [[Security_items#Flashbang|Flashbang]];
* 4 Smoke Bombs;
* Screwdriver and Multitool to customize grenades. Some different triggers can be found in the Syndicate Infiltrator Ship.
|
|-
| id="Big_Red_Button" |Syndicate Detonator
|[[file:Big_red_button.png]]
| style="text-align: center;" |3
|The Syndicate Detonator is a companion device to the Syndicate Bomb. Simply press the included button and an encrypted radio frequency will instruct all live syndicate bombs to detonate. Useful for when speed matters or you wish to synchronize multiple bomb blasts. Be sure to stand clear of the blast radius before using the detonator.
'''Operatives start with a working detonator in their base, buying this is usually redundant'''.
|
|}

=== MODsuits and Modules===
{| class="wikitable sortable"
!Item
! class="unsortable" |Icon
!Cost
! class="unsortable" |description
! class="unsortable" |info
|-
| id="Elite_Syndicate_Hardsuit" | Elite Syndicate MODsuit
|[[File:Elite MOD control.png]]
| style="text-align: center;" |8
|Works like a [[Syndicate Items#Syndicate MODsuit|Syndicate MODdsuit]], but it's more armored and completely immune to fire and acid. Useful when using fire-based weapons.
|
|-
| id="Shielded_Hardsuit" |MOD Energy Shield
|[[File:Energyshield.png|alt=]]
| style="text-align: center;" |8
|A module compatible with any MODsuit. It automatically generates a personal energy shield around the user, capable of completely nullifying a single hit, and then dissipating. The shield will reactivate after a few seconds, allowing another block.
|
|-
|MOD Injector
|[[File:Injector_module.png|alt=]]
|2
|A MODsuit module that allows you to deploy a specialized syringe that can hold up to 30u of chemicals, and inject them through any clothing the person might be wearing.
|
|-
|MODsuit Holster
|[[File:Holster_module.png|alt=]]
|2
|This module will allow you to conceal most guns, and quickly deploy them in case of need. Despite its appearance, it works with all but the biggest guns you can purchase.
|
|-
|MOD advanced EMP shield
|[[File:Empshield_module.png|alt=]]
|5
|Passive module that will protect your MODsuit from malfunctioning due to an EMP. Unlike the standard version, this won't drain your cell as much.
|
|-
|Medbeam Module
|[[file:Medgun.png]]
|15
|A specialized medical module that allows you to deploy a Medbeam Gun to your wrist at will. Using this on someone will heal them over time and at range, allowing you to keep them healthy without taking too much of your attention. You cannot target yourself

'''Crossing the streams or trying to heal a target already being healed by another medbeam will cause a huge explosion. Be very wary when using two medbeam guns, or avoid buying two altogether.'''
|
|-
|}

===Stealth and Camouflage Items ===
{| class="wikitable sortable"
!Item
! class="unsortable" |Icon
!Cost
! class="unsortable" |description
! class="unsortable" |info
|-
| id="Stealthy_No-Slip_Chameleon_Shoes" |Stealthy No-Slip Chameleon Shoes
|[[file:Brshoe.png]]
| style="text-align: center;" |4
|The nuke ops version of [[#No-Slip_Chameleon_Shoes| chameleon no-slips]].
|
|}

===Devices and Tools===
{| class="wikitable sortable"
!Item
! class="unsortable" | Icon
!Cost
! class="unsortable" |description
! class="unsortable" | info
|-
| id="Syndicate_Jaws_of_Life" |Syndicate Jaws of Life
|[[file:Syndicate_jaws.png]]
| style="text-align: center;" |4
|Based on a Nanotrasen model, this powerful tool can be used as both a crowbar and a pair of wirecutters. In its crowbar configuration it can be used to force open airlocks. Useful for entering the station or its departments.
|
|-
| id="Blood-Red_Magboots" |Blood-Red Magboots
|[[file:Syndi_magboots.png]]
| style="text-align: center;" |2
|A pair of magnetic boots that will keep you on the ground if the gravity fails or is sabotaged, giving you a mobility advantage. If activated with gravity they will protect from slips, but they will slow you down.
|
|-
| id="Assault_Pod_Targeting_Device" |Assault Pod Targeting Device
|[[file:Gangtool_red.png]]
| style="text-align: center;" |30
| This device allows you to aim and use the assault pod located to the east of the syndicate base. The doors are id-locked to operatives and it's defended by wall-mounted automatic guns, making it a safe location to retreat to if necessary.
'''It cannot return to the syndicate station, so at least one operative should send the ship onto the station to be able to come back. Also, don't forget the nuke behind!'''
|
|-
| id="Syndicate_Medical_Supply_Kit" |Syndicate Medical Supply Kit
|[[file:Syndicate_Medical_Supply_Kit.png]]
| style="text-align: center;" |4
|The syndicate medkit is a suspicious black and red. Included is a combat stimulant injector (containing 30 units of Epinephrine, 30 units of Omnizine, 15 units of Leporazine and 15 units of Atropine), a night vision medical hud for quick identification of injured comrades, a brute and burn healing patch, and a combat defibrillator that fits in belts and works through exosuits (usually useless due to explosive implants).
|
|-
| id="Syndicate_Sentience_Potion" |Syndicate Sentience Potion
|[[file:Intell_potion.png]]
| style="text-align: center;" |4
|This potion will grant intelligence (i.e. a player controller and speech) to any simple mob it is used on, also enslaving them to your commands. Additionally, the creature will receive a radio implant, as well as an implanted syndicate ID, allowing them to enter and exit the Syndicate Infiltrator.
|
|-
|Syndicate Intellicard
|
|12
|Special device that, when activated, will prompt ghosts to take the role of a carded AI. Once online, this AI can be uploaded to anything a normal AI can, including your MODsuit, though it needs to be right next to the machinery you want to control unless you buy a special upgrade. Even without it, it's still able to control your MODsuit modules and move it if you fall unconscious or die. Alternatively, you can try to replace the station AI with one of your own, if that's what you're going for.
|
|-
|AI Interaction Range Upgrade
|
|4
|Chip that allows your AI to interact with devices at longer ranges, specifically 2 tiles per use. Consecutive uses on the same AI will stack.
|
|}

===Implants===
All these items ship with an (auto) implanter; to use it, insert the implant in the implanter and use it inhand.
{| class="wikitable sortable"
!Item
! class="unsortable" |Icon
!Cost
! class="unsortable" |description
! class="unsortable" |info
|-
| id="CNS_Rebooter_Implant" |CNS Rebooter Implant
|[[file:Brain_implant.png]]
| style="text-align: center;" |12
|This implant will shorten any stun longer than 4 seconds to 4 seconds.
|
|-
| id="Microbomb_Implant" |Microbomb Implant
|[[file:injector.png]]
| style="text-align: center;" |2
|Nuclear Operatives start with bomb implants already, but if you feel like increasing the strength of the explosion, you can add more explosive implants.
|
|-
|Plausible Deniability Implant
|[[file:injector.png]]
|6
|Completely prevents both soft and hard critical condition, allowing you to stay in the fight longer! Exactly ten seconds longer, to be precise. Ten seconds after you would have entered critical condition, you explode, even if you've been healed above the threshold. Decent for one last hoorah to do as much damage to the crew as possible, but makes it so your other operatives can't save you.
|
|-
| id="Macrobomb_Implant" |Macrobomb Implant
|[[file:injector.png]]
| style="text-align: center;" |20
|A much more powerful version of the Microbomb Implant, this will cause a delayed but much more powerful explosion on death. Make sure to warn your comrades of this, as you might catch them in the blast if they're unaware.
|
|-
| id="Reviver_Implant" | Reviver Implant
|[[file:chest_implant.png]]
| style="text-align: center;" |8
|This implant will heal you once you fall into crit, then goes into cooldown.
|
|-
| id="Thermal_Vision_Implant" |Thermal Vision Implant
|[[file:eye_implant.png]]
| style="text-align: center;" |8
|Like optical thermal goggles, it lets you see all living beings through walls, and enhances your vision in the dark.
|
|-
| id="X-ray_Vision_Implant" |X-Ray Vision Implant
|[[file:eye_implant.png]]
| style="text-align: center;" |10
|Allows unrestricted vision through walls, though light level will still play a role.
|
|-
| id="Deathrattle_Implant" |Box of Deathrattle Implants
|[[file:injector.png]]
| style="text-align: center;" |4
|A collection of eight implants (and one reusable implanter) that should be injected into the team. When one of the team dies, all other implant holders recieve a mental message informing them of their teammates' name and the location of their death. Unlike most implants, these are designed to be implanted in any creature, biological or mechanical.
|
|}

===Support===
{| class="wikitable sortable"
! Item
! class="unsortable" |Icon
!Cost
! class="unsortable" |description
! class="unsortable" |info
|-
| id="Dark_Gygax" |Dark Gygax
|[[file:DarkGygax.png]]
| style="text-align: center;" |60
| One of the two assault mechs available to the operatives. At a heavy investment this mech provides a very powerful and versatile assault platform to support the assault into the station. Boasting a decent movement speed, an LBX AC 10 "Scattershot" shotgun, both types of armor boosters, and an Energy Relay, this mech proves to be as powerful as anything the operatives can bring to bear in terms of close-quarters combat prowess. However, it is extremely vulnerable to [[Guide_to_Combat#Ion Rifle|ion guns]], which will seriously damage the mech in a few hits. Consider not bringing your ship's ion gun along for the assault. Aside from the ion gun, the only easy way to bring it down is other EMPs, mass laser fire or a ton of explosives. It also has a leg actuator function, which speeds up the mech.
Has thrusters for space-maneuverability.
|
|-
| id="Dark_Mauler" |Dark Mauler
|[[file:DarkMarauder.png]]
| style="text-align: center;" |100
|The single most expensive item available to the Operatives, the Dark Mauler is an unholy terror to behold to even the most elite of Security personnel. Carrying a mounted LMG, a Scattershot gun, a Missile Rack, a Power Relay for infinite power and special anti-ranged armor, this monster can destroy the station ten-fold with the equipment it carries. Its armor makes it nearly impossible to destroy by all but the most concentrated, coordinated and well armed of counter attacks. Its main weakness is that it is very slow moving, making it easy to outrun. It can, however, walk through walls without any trouble, making most stationary fortifications pointless. Note that this does not, however, automatically make you unstoppable. To effectively use it you should already have some experience with mechs, it should also be noted that whoever is piloting this does not need as much gear as everyone else, so don't waste TC (although it is good to have a backup plan if the mech is destroyed).
|
|-
| id="Syndicate_Cyborg" |Syndicate Cyborg
|[[file:Syndieborg.png]]
| style="text-align: center;" |65
|A repurposed Nanotrasen Cyborg, outfitted with the latest in Syndicate technology. This powerful killing machine has many great utilities that make it almost a necessary asset for many Nuke Op teams. Can either be an Assault, Medical or Engineering module. 
*The assault module contains:
**A [[Security_items#Flash|flash]];
**An [[#Energy_Sword|energy sword]];
**A cyborg LMG that prints ammo from energy;
**A grenade launcher;
**An [[#Cryptographic_Sequencer|emag]];
**A crowbar;
**A pinpointer;
*The medical module contains:
**A [[Security_items#Flash|flash]];
** A [[#Medical_bundle|syndicate hypospray]] containing restorative nanites;
**Medical Gauze;
**A defibrillator;
** A [[#Medbeam_Gun|Medbeam Gun]];
**A health analyzer;
**Surgery tools (The surgical saw can be toggled to be an energy sword);
**An [[#Cryptographic_Sequencer|emag]];
**A crowbar;
**A pinpointer.
*The saboteur module contains:
**A full set of tools;
** Metal, glass and cable synthesizers;
**A robotic RCD;
** A robotic RPD;
**A fire extinguisher;
**Zipties;
**A flash;
**Thermal vision;
**A fake destination tagger;
**A cyborg chameleon projector;
**A pinpointer.

The Syndicate cyborg is occupied by a ghost with the operative preference enabled. If there are no candidates, you can refund the telecrystals by hitting the uplink with the teleporter you get from ordering the cyborg.
|
|-
| id="Reinforcements" |Reinforcements
|[[file:Generic_nukesyndie.png]]
| style="text-align: center;" |25
|Gives a Reinforcement Teleporter. When used, a random ghost will become a new member of the nuke operative squad! The reinforcement starts with the normal operative equipment minus the TC, therefore someone has to equip them to make them useful: in particular, make sure there are enough spacesuits to get to the station.
|
|-
|Overwatch Reinforcement
|[[File:Overwatch Agent.png]]
|12
|You'll receive a Reinforcement Teleporter. When you activate it, ghosts will be prompted to become a Syndicate Overwatch Agent. If any were to accept, they'll spawn in the sealed bunker northwest of the base, with boards to build another infiltrator control console, an advanced camera console, a station announcements console, and a last, special computer that lets you watch your team via pre-oinstalled bodycams. Their headset has a loud mode, just like the station heads' ones, and they start with the Codespeak language by default.
Useful if you need more coordination or if you plan on using the Steel Rain drop pod.
|
|}

===(Pointless) Badassery===
{| class="wikitable sortable"
!Item
! class="unsortable" |Icon
!Cost
! class="unsortable" |description
! class="unsortable" |info
|-
| id="Broken_Chameleon_Kit" |Broken Chameleon Kit
|[[file:Syndibox.png]][[file:Changeling.gif]]
| style="text-align: center;" | 4
|A full chameleon kit, gun aside, that acts as if EMP'd. You will stick out like a sore thumb and be unable to wear "real" armor.
|
|-
| id="Centcom_Official_Costume" |Centcom Official Costume
|[[file:Syndibox.png]][[file:centcomcommander.png]]
| style="text-align: center;" |4
|Contains a full CentCom Official uniform set, headset and clipboard included. The headset comes without an encryption key.
|
|-
| id="Clown_Costume" |Clown Costume
|[[file:Clownduffle.png]][[file:Generic_clown.png]]
| style="text-align: center;" | 4
|Contains a complete [[Clown]] outfit.
|
|-
| id="Sleepy_Time_Pajama_Bundle" |Sleepy Time Pajama Bundle
|[[file:Syndibox.png]][[File:Syndi_pajama.png]]
| style="text-align: center;" |4
|Even soldiers need to get a good nights rest. Comes with blood-red pajamas, a blankie, a hot mug of cocoa and a fuzzy friend.
|
|}

=Clown Operative Equipment=

'''STATION PRANKS GONE WRONG!''' You have been chosen by the clownpeople to lead a daring prank raid (''praind??'') on one of nanotrasen's space station. While this prank is sponsored by the syndicate coalition, your clown honor (and genes) dictates that you do not use certain BORING equipment standard nuclear operatives are known for, and instead opt for the more !FUN! equipment you are accostumed to as a clown.

'''Here are some of the biggest changes from the normal operative kit:'''

{| class="wikitable" style="text-align: center;"
|'''Absolutely no guns!'''
|'''You can use: ...'''
|-
|[[file:bulldog.png]][[file:c20r.png]][[file:sniper.png]]
|[[file:Pie_cannon.png]] The pie cannon! [[file:fake_c20r.png]][[file:fake_SAW.png]] Foam weapons! [[file:paperplane.png]] Origami!
|-
|'''No energy sword/shield!'''
|'''Bananium weapons!'''
|-
|[[file:sword.gif]][[file:DoubleESword.png]][[file:eshield.png]]
|[[file:banana_sword.gif]][[file:banana_shield.png]] They are slippery on the floor, and the sword is totally harmless, but slips people you hit!
|-
|'''No lame bombs!'''
|'''Use funny bombs!!'''
|-
|[[file:syndicate_Bomb.gif]][[file:Syndicate_Minibomb.gif]]
|[[file:clownbomb.png]] Summon a horde of clowns! [[file:moustache_grenade.png]]Slap a funny moustache on people's faces! (Also teargas!!) [[file:banana.png]]Blow them up with the explosive peel!
|-
| colspan="2" |'''Bioweapons are A-OK!!'''
|-
| colspan="2" |'''Other funny equipment:''' [[file:clown shoes.png]] Combat clown shoes that don't slip, bananium version that leaves peels behind also available! [[file:firingpinclown.png]] Funny firing pins that only let other clowns use a gun, or VERY funny pins that explode when pulled!!
|-
| colspan="2" |[[file:dark_honk.png]] '''A MECH!!!'''
|-
| colspan="2" |'''NO CLOWN CAR!!'''
|}

[[Category:Objects]]
[[Category: Weapons]]

'''CURRENTLY UNUSED EQUIPMENT'''
<div style="text-align: left; max-width: 95%">{{#tag:tab|

===Contract Kit===
A special kit for traitors only. '''CURRENTLY REMOVED FROM THE CODE. YOU CAN NO LONGER BUY THE CONTRACTOR KIT.'''
{{anchor|Contract Kit}}
{{Item
|bgcolor1 = #cccccc
|bgcolor2 = #cccccc
|name = "Contract Kit"
|image = Contract uplink.gif
|foundin = Ordered via syndicate uplink, costs 20 telecrystals.
|usedfor = Completing kidnapping contracts for TC-rewards.
|strategy = A high risk, high reward choice for a traitor who wants a real challenge.
|description = '''20+ players only''' The Syndicate have a number of urgent contracts for you to take on, become a contractor and complete them for TC and cash payments. Upon purchase, you'll be granted your own contract uplink embedded within a supplied tablet computer. Additionally, you'll be granted contractor gear to help with your mission. Comes supplied with the tablet, a specialist contractor space suit, [[#Chameleon_Kit|chameleon jumpsuit]] and [[#Chameleon_Kit|mask]], [[#Agent_ID_Card|agent card]], three randomly selected low cost items, and a unique, [[#Contractor Baton|electrified baton]]. Can include items from nuke ops.

Use the new contract uplink to select a contract, and bring the assigned target dead or alive to the designated drop off location. Call for the extraction pod and send them off for your payment, with much higher rewards for keeping them alive. Extracted targets will be sent to the [[Ninja|ninja]] jail and held for ransom by the Syndicate, alerting the crew after a small delay. Ransom will be payed automatically by [[Nanotrasen]], taking an amount of the station budget to offset the cost. These targets will later be returned to the station, with even targets brought and extracted dead being returned to the crew. The contractor always earns a portion of the ransom when they're extracted into their equipped ID.

Victims that're extracted will have their items stored until they're brought back, with their items coming along with the pod they're dropped with. Extracted targets always get dropped back in the same area they were launched from.

Aborting or completing contracts will make them unavailable to take on again, so be mindful of this when choosing which target to pick. Extraction will come when requested, but only if both yourself and the target is inside the dropoff location.

The average for the total TC you can earn with this kit is around 34 TC, with the minimum never being below 30, should you extract all your targets alive. This is on top of the actual value this kit gives you initially, making this an incredibly viable choice if you can justify a weaker early game, and feel up to the challenge.

Currently, when first assigning yourself to the uplink, you'll always be given 6 contracts.

Unique items are available to purchase with "Contractor Rep" through the available Hub inside the uplink. You acquire two Rep per completed contract, with five different purchases available:
* '''Contract Reroll - 2 Rep''': Request a reroll of your current contract list. Will generate a new target, payment, and dropoff for the contracts you currently have available.
* '''Contractor Pinpointer - 1 Rep''': A pinpointer that only activates for its owner, which is the first person to activate it. Locks on to crew on the same z-level, ignoring suit sensors, but is much less accurate. Will show you're at the location when within ~25 units.
* '''Fulton Extraction Kit - 1 Rep''': Gives both a beacon and fulton kit to move targets/items across the station. Place the beacon down, and use the bag in hand to link it. Using the bag on items and crew will send them to the beacon. They must be outside - so in space or on lavaland - to be sent to the beacon.
* '''Reinforcements - 2 Rep''': Call in a Syndicate agent to help you with your mission. Role is polled to ghosts, and comes with very basic items and their own 0 TC uplink. When an agent is found, they'll be sent via pod, so be sure to call when by yourself.
* '''Blackout - 3 Rep''': Cuts station power for a short duration.

====[[File:Contractor_baton_retracted.png]]Contractor Baton[[File:Contractor_baton_extended.png]]====
This baton comes in every contract kit. Use in hand to extend or retract. Fits in a pocket when retracted. If extended: 
{{Leftclick}} Causes 1.5 seconds of [[Status_Effects#Knockdown|knockdown]] and 85 [[Health#Stamina|stamina]] damage, which means it will [[Health#Stamina|stamcrit]] someone with 2 hits. Has a 2.5 second cooldown. Unlike [[Security_items#Stun_Baton|other batons]], this one works on [[Cyborg|cyborgs]]. 
{{Rightclick}} Simply deals 16 brute damage with no cooldown.
}}
|dropdown|collapsed=true|closename=Click to retract|openname=Click to expand}}</div>

Руководство по генетике

2026-02-26T17:07:19Z

Krytoi: Пользователь этого генома может визуально воспринимать уникальную тепловую подпись человека." Изменено на: Пользователь этого генома может видеть уникальный тепловой силуэт человека

{{NeedReview}}
{{Speech
|name=Рут МакВорк
|text=Добро пожаловать в [[Genetics|генетику]], брат! Ты чувствуешь себя хорошо? Ты ДОЛЖЕН чувствовать себя хорошо! Теперь ты подобен крошечному богу! Готов ли ты стать тем, кем был рожден? Готовы ли ты спасти станцию (или полностью ее испортить)?
Выше нос, приятель. Это не так уж и сложно. Но прежде чем ты начнешь хватать обезьян из загона, ты должен знать основы.
|image=[[File:Geneticist.png|64px|right]]
}}

== Департамент ==
[[File:Genetics.png|thumb|240px|right]]
Добро пожаловать в [[Genetics|генетику]].

Эта комната оснащена двумя [[Machines#DNA_Scanner|DNA Scanner]](ДНК сканерами) и двумя DNA Scanner Access Консолями, вместе с коробками для дисков и другим инвентарем. Диски очень полезны, как мы увидим позже.

В соседней изолированной комнате находятся ваши подопытные. Эти обезьяны станут вашими подопытными кроликами. Вы будете ставить на них эксперименты и заставлять их страдать. Это довольно бесчеловечно. Но такова жизнь, и через некоторое время все это будет стоить того.

== [[File:scanner.gif|32px]][[File:Medcom.gif|32px]] Модификация ДНК ==
[[File:Unique_identifiers_tab.png|thumb|200px|right|This is the "Enzymes" tab. The "Radiation Emitter" function may randomize certain individual cosmetic features of the person inside, as well as damage their DNA. This menu can be used to transfer identities between people, but it can't be used to change a person's species. This information can also be stored on cloning data disks. Regarding the genetic research, listen to the direct orders of the [[Research Director]]]].

Теперь давайте познакомимся с консолью доступа к сканеру ДНК. В ней есть несколько важных моментов. Для начала вам нужно выучить несколько терминов:

===Unique Enzymes===
* Unique Enzymes (UE) = '''Ваше имя'''. Даже если вы мутируете UE, это никак не повлияет на имя. Однако что вы можете сделать, так это передать UE от одного человека к другому, скопировав его имя.

===Unique Identifiers===
* Unique Identifiers (UI) = '''Ваши косметические детали''' - цвет глаз, цвет кожи, стиль прически, цвет прически и пол. 

В консоли доступа к сканеру ДНК есть вкладка с названием "Enzymes". Эту вкладку можно использовать для копирования UE и UI между людьми.
*Нажмите "Save" Чтобы сохранить UE + UI в консоли. Вы не можете сохранять мутации таким образом (больше не можете).
*Нажмите "Transfer" чтобы скопировать гены буфера тому, кто находится внутри сканера. Вы можете выбрать между '''Enzymes''' (UE), '''Identity''' (UI) и '''Full Makeup''' (UE+UI).
*Нажмите "Transfer (Delayed)" чтобы скопировать гены буфера следующему человеку, который зайдет в сканер и закроется там (например, вы сами). Эта опция доступна только в том случае, если сканер пуст.
*Нажмите "Print" для печати ДНК-инжектора, содержащего гены из сохраненного буфера. Введя его человеку, вы передадите ему UE, UI или UE+UI. Однако, в отличие от инжекторов мутаций, эти инжекторы ДНК не являются постоянными и действуют лишь некоторое время после введения.

===Structural Enzymes===
* Structural Enzymes (SE) / Genetic Sequence = '''Ваши мутации'''. Они содержат данные о вашей генетической структуре. Это определяет вашу расу и мутации. Термин «Structural Enzymes» больше не используется в консоли доступа к сканеру ДНК, поскольку он был заменен на «Genetic Sequence» (что одно и то же), но этот термин все еще может встречаться в других местах.

=== Genetic Sequencer ===
[[File:Genetic_Sequencer.png|thumb|200px|right|Так может выглядеть вкладка Sequencer, когда в сканере находится человек.]]
В консоли DNA scanner access есть вкладка "Sequencer". Тут вы изменяете гены чтобы найти мутации. Здесь вы будете изменять гены, чтобы найти мутации. Существует '''четыре''' типа блоков: A, T, C и G. Каждая пара букв в этих блоках соединена. '''A соединяется с T, и G соединяется с C.''' Порядок не имеет значения. В каждой паре есть правильная комбинация "AT, TG, CG или GC" которую нужно заполнить. Если вы видите немодифицированную пару X-T то это значит, что правильная комбинация будет A-T. Когда все 16 пар будут иметь правильные блоки, мутация активируется и откроется у вас в консоли, тем самым вы сможете сохранить ее. У мартышек может быть только мутация ''monkified'' пока они не [[#Humanizing_a_Monkey|очеловечены]]. Как только вы нашли название мутации, эта мутация может быть идентифицирована в DNA scanner access consoles. 

Возможно, вы захотите отключить мутацию обезьяны, заменив одну из здоровых пар на другую букву. Как это сделать, подробно описано [[#Guide_to_finding_and_using_mutations|руководстве ниже]]. 

====[[File:Gene_scanner.gif]] Genetic Sequence Scanner====
[[File:Gene_scanner_results.png|thumb|200px|right|Как это выглядит после щелчка на ком-то с помощью элемента «Genetic Sequence Scanner», а затем с помощью Genetic Sequence Scanner в руках и выбора «Mutation 39». Обратите внимание, что теперь мы знаем, что первая пара должна быть C-G. ]]
В более сложных мутациях будет много неизвестных пар '''(X-X)'''. Вы не можете просто случайно ввести A-T, поскольку раундстартом предопределено, что должно быть. Зная все это, вы можете воспользоваться сканером генетических последовательностей '''(Genetic Sequence Scanner)'''.[[File:Gene_scanner.gif]] который находится раундстартом в вашем кармане. Если вы ищете правильные пары с мутацией 39, сканируйте людей, пока не найдете человека с мутацией 39. Затем используйте сканер в руке, чтобы появилось меню. В меню выберите «мутация 39». Это даст вам показания, которые, вероятно, дадут вам больше информации о том, какие пары вам нужны для завершения мутации 39.
[[File:Genetic_Sequencer_solved.png|thumb|200px|right|Как это выглядит после правильного заполнения всех пар. Мутация 39 оказалась monkified. Поскольку разгадка мутации активирует ее, субъект в сканере теперь обезьяна.]] 

Вы можете использовать Genetic Sequence Scanner [[File:Gene_scanner.gif]] на DNA scanner access на консоли доступа к сканеру ДНК, чтобы навсегда синхронизировать предмет, что позволит вам видеть названия обнаруженных мутаций при сканировании людей с его помощью. 

Более подробную информацию о некоторых других вкладках можно найти в [[#Guide_to_finding_and_using_mutations|разделе далее]].

===[[File:Hulk.png]] Список мутаций===
{{Anchor|Mutations and Their Consequences}}
Прежде чем мы приступим к синтезу, вы должны знать, какие чудовищные вещи можно сделать с человеком.
Обычно недостижимые мутации выделены красным шрифтом.

{| class="wikitable sortable mw-collapsible" border="1" cellspacing="0" cellpadding="2"
!style = "background:{{ColorPalette|Medical|Primary}};"|Mutation Name
!style = "background:{{ColorPalette|Medical|Primary}};"|Description
!style = "background:{{ColorPalette|Medical|Primary}};"|Indicators
!style = "background:{{ColorPalette|Medical|Primary}};"|Message
!style = "background:{{ColorPalette|Medical|Primary}};"|How/Where to Obtain
!style = "background:{{ColorPalette|Security|Primary}};"|Instability

|-
!Telekinesis
|''"Странная мутация, позволяющая владельцу взаимодействовать с предметами с помощью мысли."''
Эта сила позволяет субъекту управлять предметами с помощью своего разума, находясь на большом расстоянии! Это самая востребованная сила, поскольку она позволяет совершать невероятные поступки и делает сильного робаста почти бессмертным. Чтобы использовать ее, переключитесь на пустую руку и нажмите на предмет (обратите внимание, что, если вы можете, ваш персонаж/игра будут отдавать предпочтение обычному взятию предмета, а не телекинетическому). Под предметом и в вашей руке появится символ круга, и теперь вы можете управлять предметом. Вы также можете использовать любую консоль на расстоянии.
|Появляется в виде голубого свечения вокруг головы субъекта.
|style='color:#0000ff'|''"You feel smarter"''
|Генетика / [[Sects|Секта свящееника]]
|30
|-
!Hulk
|''"Малоизученный геном, который заставляет мышцы обладателя расширяться, затрудняет речь и вызывает позеленение кожи."''
Субъект становится чрезвычайно сильным, что позволяет пробивать укрепленные стены и не может говорить без крика. Объект также невосприимчив к оглушению и замедлению от выносливости и обычного урона, и его нельзя пробить. Разрушение стен и механизмов наносит сильный физический урон руке. Эта мутация пропадает, когда здоровье субъекта падает до критического уровня.
* Может раскручивать людей за хвосты. Чтобы сделать это, схватите жертву в третий захват, включите режим броска и нажмите в направлении, в котором хотите бросить.
* Делает вас очень уязвимым к холоду и наносит физический урон от него.
* Запрещает вам использовать оружие из за ваших больших пальцев
|Субъект становится зеленым и с красными глазами.
|style='color:#0000ff'|''"Your muscles hurt."''
|Radioactive + Strength
|40
|-
!Temperature Adaptation
|''"''Странная мутация, делающая носителя невосприимчивым к повреждениям от экстремальных температур, как горячих, так и холодных. Не защищает от вакуума [или областей высокого давления].''."''

'''Эта мутация является взаимоисключающей с Pressure Adaptation.'''
|Объект имеет пульсирующую оранжевую «ауру».
|style='color:#0000ff'|''"Your body feels warm."''
|Генетика
|25
|-
!Pressure Adaptation
|''"''Странная мутация, делающая носителя невосприимчивым к повреждениям, наносимым средами низкого и высокого давления. Не защищает от температуры, включая холод космоса [или сверхгорячего газа].''."''

'''Эта мутация является взаимоисключающей с Temperature Adaptation.'''
|Объект имеет пульсирующую голубую «ауру».
|style='color:#0000ff'|''"Your body feels numb."''
|Генетика
|25
|-
!Thermal Vision
|''"Пользователь этого генома может видеть уникальный тепловой силуэт человека."''
Субъект может видеть людей даже сквозь стены и в темноте. Наносит 10 повреждений глазам при использовании и длится около 10 секунд.
|\
|style='color:#0000ff'|''"You can see the heat rising off of your skin..."''
|Генетика
|25
|-
!Chameleon
|Субъект становится способным тонко изменять характер света, чтобы стать невидимым, пока он остается неподвижным.
|Субъект начинает сливаться с окружением.
|style='color:#0000ff'|"''You feel one with your surroundings.''"
|Генетика
|25
|-
!Dwarfism
|Превращает субъекта в гнома, делая его необычайно коротким по сравнению с остальными членами команды. Карлики могут проходить над столами,не получая штраф.

'''Взаимоисключающая мутация с Gigantism'''
|Субъект выглядит меньше.
|style='color:#0000ff'|''"Everything around you seems to grow.."''
|Человеческая раса
|5
|-
!Near Sightness
|''"У обладателя этой мутации плохое зрение."''
Экран субъекта становится мутным примерно на половину вашего зрения. Это не так уж и плохо, и может быть временно исправлено с помощью рецептурных очков.
|\
|style='color:#ff0000'|''"You can't see very well."''
|Генетика
|-
!Epilepsy
|Субъект начинает падать и все время трясется.
|Субъект страдает от припадков.
|style='color:#ff0000'|''"You get a headache."''
|Генетика
|-
!Coughing
|Заставляет субъекта ронять мелкие предметы, которые он держит в руках, например шприцы. Довольно безобидно, но потенциально может быть крайне раздражающим.
|Субъект кашляет
|style='color:#ff0000'|''"You start coughing."''
|Генетика
|-
!Tourette's Syndrome
|Субъект постоянно ругается. Также может наступить паралич.
|Субъект громко ругается и дергается.
|style='color:#ff0000'|''"You twitch."''
|Генетика
|-
!Nervousness
|Заставляет субъекта заикаться. В лучшем случае раздражает.
|Субъект заикается при разговоре.
|style='color:#ff0000'|''"You feel nervous."''
|Генетика
|-
!Blindness
|Субъект полностью слепнет, становясь частью обычно забытого меньшинства. Как печально.
|Глаза субъекта не реагируют на свет.
|style='color:#ff0000'|''"You can't seem to see anything."''
|Генетика
|-
!Deafness
|Делает субъекта глухим. В лучшем случае безвредно, в худшем - раздражает. Вы просто ничего не слышите, даже себя.
|\
|style='color:#ff0000'|''"You can't seem to hear anything..."''
|Генетика
|-
!Illiterate
|Субъект становится неграмотным, что мешает ему пользоваться бумагой, ручками, компьютерами и некоторой электроникой, требующей чтения.
|\
|style='color:#ff0000'|''"You feel unable to read or write."''
|Генетика
|-
!Clumsiness
|Подавляет определенные функции мозга, вызывая у субъекта клоунскую неуклюжесть. Для тех, кто всегда хотел быть клоуном. Из-за этого субъект случайно роняет предметы, которые держит в руках, не может использовать станбатоны, наручники, выстрел из пистолета скорее всего ранит субъекта и т. д.
|\
|style='color:#ff0000'|''"You feel lightheaded."''
|Генетика/Клоун
|-
!Unintelligible
|Сильно повреждает часть мозга, отвечающую за формирование предложений, в результате чего субъект может говорить только короткими фразами.
|\
|style='color:#ff0000'|''"You can't seem to form any coherent thoughts!"''
|Генетика
|-
!Mute
|Полностью отключает центр речи в мозгу субъекта.
|\
|style='color:#ff0000'|''"You feel unable to express yourself at all."''
|Генетика / [[Sects|Секта священника]]
|-
!Wacky
|Заставляет субъекта говорить в странной манере. Заставляет вашу речь в чате использовать шрифт Comic Sans, который обычно можно увидеть только в мегафоне клоуна.
|\
|''"You feel an off sensation in your voicebox."''
|Генетика
|-
!Glowy
|Придает субъекту слабое свечение случайного цвета.

''Взаимоисключающие с Anti-Glow''
|Субъект светится.
|style='color:#0000ff'|''"Your skin begins to glow softly."''
|Генетика
|5
|-
!Anti-Glow
|Заставляет субъект поглощать свет в радиусе вокруг себя.

''Взаимоисключающие с Glow; работает с этериалами''
|Субъект обладает аурой тьмы. Излучает кольцо белого света в светоизлучающих расах.
|style='color:#0000ff'|''"Your skin seems to attract and absorb nearby light creating 'darkness' around you."''
|Glowy + Void Magnet
|5
|-
!Strength
|''"Мышцы пользователя слегка расширяются."''
Субъект чувствует себя сильнее, но это не так. Соедините с Радиоактивным, чтобы получить силу Халка.
|\
|style='color:#0000ff'|''"You feel stronger"''
|Генетика
|-
!Fiery Sweat
|Субъект "потеет '''жидким огнем'''" и случайным образом сгорает, но становится более устойчивым к огню. Тесты показали, что субъектам требуется в два раза больше времени, чтобы полностью сгореть (модификатор x0.5 на ожоги). [[#Genetic_Instability|Стабильность]] снижает вероятность возгорания.
|Субъект самовозгорается
|style='color:#ff0000'|''"You feel hot."''
|Генетика
|-
!Void Magnet
|"''Редкий геном, притягивающий странные силы, которые обычно не наблюдаются.''"
У вас есть возможность на короткое время сделать себя неуязвимым, но при этом вы не можете двигаться. Вы также будете входить в это состояние случайно и против своей воли, но генетическая [[#Genetic_Instability|стабильность]] снижает частоту этого.
|Субъект периодически заменяется дырой в реальности, имеющей форму субъекта.
|style='color:#0000ff'|''"You feel a heavy, dull force just beyond the walls watching you."''
|Генетика
|30
|-
!Radioactive
|''"Мутация, которая заставляет носителя испускать смертоносное бета-излучение. Это влияет как на носителей, так и на их окружение."''
Один из немногих источников излучения после изменений в радиационной модернизации.
|Субъект светится зеленой аурой
|style='color:#ff0000'|''"You feel it in your bones"''
|Генетика
|5
|-
!Telepathy
|Мутация, позволяющая пользователю телепатически общаться с другими людьми.
|Субъект способен транслировать свои мысли непосредственно другим людям.
|style='color:#0000ff'|''"You hear your thoughts echo in your mind"''
|Генетика / [[Sects|Секта священника]]
|10
|-
!Fire Breath
|Древняя мутация, которая наделяет ящериц огненным дыханием.
Позволяет стрелять взрывными огненными шарами, чем горячее шар, тем меньше он пролетит.
|Субъект обретает способность дышать концентрированными огненными шарами.
|style='color:#0000ff'|''"You feel a heat built up in your throat"''
|Раса ящеров
|30
|-
!Chav
|Заставляет языковой центр мозга субъекта строить предложения в более примитивной манере.
|\
|style='color:#0000ff'|''"Ye feel like a reet prat like, innit?"''
|Генетика
|-
!Swedish
|''"Ужасная мутация родом из далекого прошлого. Считается уничтоженной после инцидента в 2037 году.."''
Заставляет языковой центр мозга субъекта строить предложения в неясной нордической манере.
|\
|style='color:#0000ff'|''"You feel Swedish, however that works."''
|Генетика
|-
!Medieval
|''"Ужасная мутация, происходящая из далекого прошлого, которая, как считается, когда-то была обычным геном во всей Европе старого света."''
Заставляет языковой центр и первичную моторную кору мозга субъекта говорить и действовать, как рыцарь в поисках Святого Грааля.
|\
|style='color:#0000FF'|''"You feel like seeking the holy grail!."''
|Генетика
|-
!Pig Latin
|''"Историки утверждают, что еще в 2020-х годах человечество говорило исключительно на этом мистическом языке.."''
Уменьшает количество скиллчипов для субъекта, с которыми он может работать
|\
|style='color:#0000FF'|''"Omethingsay eelsfay offyay."''
|Генетика
|5
|-
!Insulated
|Это делает вас устойчивым к ударам тока, что совсем не похоже на ношение резиновых перчаток, но без отрицательных сторон.
|Субъект не проводит электричество.
|style='color:#0000ff'|''"Your fingertips go numb."''
|Генетика
|25
|-
!Shock Touch
|''"Обладатели этой способности могут проводить избыток электричества через руки, не поражая себя, что позволяет им поражать других."''
Это дает вам неантагонистическую Mansus Grasp, которая бьет людей током, нанося урон от ожогов и вызывая сильное дрожание и замешательство. Не защищает субъекта от ударов.
|Субъект может ударить током других людей голыми руками.
|style='color:#0000ff'|''"You feel power flow through your hands."''
|Insulated + Radioactive
|30
|-
!Transcendent Olfaction
|''"Ваше обоняние сравнимо с собачьим."''
Эта способность позволяет отслеживать людей по запаху. Возьмите что-нибудь в руку и с помощью силы найдите на нем запах. Если использовать силу, не держа ничего в руках, вы будете отслеживать запах, который нашли ранее. Полезно для детектива.
|\
|style='color:#0000ff'|''"Smells begin to make more sense..."''
|Генетика
|30
|-
!Geladikinesis
|Позволяет концентрировать влагу из воздуха в снег
|Эта мутация позволяет создавать снег, который используется для строительства снежных плит, стен, шаров и снеговиков.
|style='color:#0000ff'|''"Your hand feels cold"''
|Генетика
|10
|-
!Cryokinesis
|Извлекает отрицательную энергию из отрицательной пустоты, чтобы стрелять замораживающими лучами.
|Позволяет стрелять криокинезом, чтобы замораживать людей, предметы и плитки.
|style='color:#0000ff'|''"Your hand feels cold"''
|Генетика
|20
|-
!Antenna
|У испытуемого прорастает антенна. Это, как известно, позволяет им получать пассивный доступ к распространенным радиоканалам.
|Антенна находится на голове пользователя, и по сути это встроенная радиостанция.
|style='color:#0000FF'|''"You feel an antenna sprout from your forehead."''
|Генетика
|5
|-
!Mind Reader
|Испытуемый может заглянуть в недавние воспоминания других людей.
Они могут читать мысли других людей. Это позволит узнать имя объекта и некоторые фрагменты того, что он говорил в прошлом. Известно, что оловянная фольга блокирует эту способность.
|На голове пользователя появляется антенна, и читающий может почувствовать, как в его сознание проникает что-то странное.
|style='color:#0000FF'|''"You hear distant voices at the corners of your mind."''
|Antenna + Paranoia / [[Sects|Секта священника]]
|40
|-
!Spatial Instability
|Жертва мутации имеет очень слабую связь с пространственной реальностью и может быть смещена. Часто вызывает сильную тошноту.
|Субъект случайным образом телепортируется на небольшое расстояние и имеет склонность увеличивать нагрузку на уборщика.
|style='color:#FF0000'|''"The space around you twists sickeningly."''
|Генетика
|10
|-
!Paranoia
|''"Субъект легко пугается и может страдать от галлюцинаций."''
|Субъект часто кричит
|style='color:#FF0000'|''"You feel screams echo through your mind..."''
|Генетика
|-
!Gigantism
|Клетки внутри субъекта раздвигаются и занимают большую площадь, отчего кажутся крупнее.
Взаимоисключающее с Дворфизмом
|Субъект немного больше, чем обычно
|style='color:#0000ff'|''"Everything around you seems to shrink.."''
|Генетика
|-
!Two Left Feet
|''"Мутация, при которой правая нога заменяется левой. Симптомы включают поцелуй пола при шаге."''
|Субъект случайным образом [[Status_Effects#Knockdown|сбивается с ног]].
|style='color:#FF0000'|''"Your right foot feels... left."''
|Генетика
|-
!Tongue Spike
|Позволяет существу добровольно высунуть язык и использовать его в качестве смертельного оружия.
Язык не отрастает и остается в человеке до тех пор, пока его не удалят.
|Субъект может стрелять языком.
|style='color:#0000FF'|''"Your feel like you can throw your voice."''
|Генетика
|15
|-
!Stimmed
|Химический баланс пользователя становится более прочным. (Ничего не делает.)
|\
|style='color:#0000FF'|''"You feel stimmed."''
|Генетика
|-
!Chem Spike
|Позволяет существу добровольно высунуть язык в виде биомассы, что позволяет передавать химические вещества на большое расстояние.
Язык не отрастает, а остается встроенным в человека до тех пор, пока его не удалят. Пока он внедрен, он позволяет вам перевести химическое вещество из вашего тела в тело цели, один раз. Это гораздо менее опасно, чем «Tongue Spike» сам по себе.
|Субъект может выстрелить своим языком и ввести вам химические вещества.
|style='color:#0000FF'|''"Your feel like you can really connect with people by throwing your voice."''
|Tongue Spike + Stimmed
|15
|-
!Webbing Production
|Позволяет прокладывать паутину и перемещаться по ней.
Субъект может психологически привязаться к укладке паутины, если использовать его достаточно часто.
|Субъект укладывает паутину или может двигаться сквозь нее без замедления.
|style='color:#0000FF'|''"Your skin feels webby."''
|Генетика
|15
|-
!Internal Martyrdom
|''"Мутация, из-за которой тело разрушается в момент смерти. Не наносит вреда окружающим, но очень, очень дезориентирует."''
Вредно для глаз свидетелей. Парализует также силиконов.
|Субъект взрывается кровавым душем, когда находится в хардкрите.
|style='color:#0000FF'|''"You get an intense feeling of heartburn."''
|Strong + Stimmed
|-
!H.A.R.S.
|Мутация, из-за которой организм отторгает голову. Расшифровывается как Head Allergic Rejection Syndrome или синдром аллергического отторжения головы. Предупреждение: Удаление этой мутации очень опасно, хотя она и восстанавливает органы головы.
|Субъект теряет голову, включая глаза, уши, язык и т.д.
|style='color:#FF0000'|''"Something feels off."''
|Генетика
|-
!Acidic Flesh
|''"У субъекта под кожей накапливаются кислотные химические вещества. Это часто приводит к летальному исходу."''
В итоге эти скопления превращаются в кислотные кожные высыпания, обжигающие субъекта. Кислотостойкая одежда защищает субъекта от таких высыпаний..
|Кожа субъекта часто пузырится и шипит, обжигая его.
|style='color:#FF0000'|''"A horrible burning sensation envelops you as your flesh turns to acid."''
|Генетика
|-
!Spastic
|''"Субъект страдает от мышечных спазмов."''
Субъект может непреднамеренно задеть находящихся рядом людей и технику, а также нанести себе вред.
|У субъекта часто бывают спазмы.
|style='color:#FF0000'|''"You flinch."''
|Генетика
|-
!Monkified
|''"Странный геном, считающийся тем, что отличает обезьян от людей."''
Превращает субъекта в обезьяну. Врожденная мутация у людей и обезьян.
|У субъекта часто бывают спазмы.
|''"You feel unusually monkey-like."''
|Генетика
|-
!Autotomy
|''"Позволяет существу добровольно выбросить случайный придаток."''
|Субъект способен отбросити конечности без хирургического вмешательства.
|style='color:#0000FF'|''"Your joints feel loose."''
|Генетика
|30
|-
!Biotech Compatibility
|''"Субъект более совместим с биотехнологиями, такими как скиллчипы."''
Дает возможность субъекту использовать больше скиллчипов
|\
|Нет сообщения
|Генетика
|5
|-
!Clever
|''"Заставляет субъекта почувствовать себя немного умнее. Наиболее эффективен для образцов с низким уровнем интеллекта."''
Позволяет некоторым мобам, например обезьянам, выполнять такие сложные действия, как хирургические операции, пользоваться компьютерами и КПК, и многое другое.
|\
|style='color:#FF0000'|''"You feel a little bit smarter."''
|Генетика
|20
|-
!style='color:#ff0000'|Stoner
|''"Распространенная мутация, сильно снижающая интеллект."''
Предоставляет язык Beach Bum, отменяет все остальные.
|\
|style='color:#0000FF'|''"You feel...totally chill, man!"''
|Спавн на пляже
|}

==== Эксклюзив для [[Sects|Сект священника]] ====
Мутации, дарованные некоторыми [[Sects|сектами]] священника. Уменьшают нестабильность генов до 0.

''"Не столько геном, сколько насильственное переписывание генов. Ничто из того, что поставляет Нанотрейзен не позволяет провести подобную генетическую перестройку..."''

{| class="wikitable sortable mw-collapsible mw-collapsed" border="1" cellspacing="0" cellpadding="2"
!style = "background:{{ColorPalette|Medical|Primary}};"|Name
!style = "background:{{ColorPalette|Medical|Primary}};"|Description
!style = "background:{{ColorPalette|Medical|Primary}};"|Message
|-
!Honorbound
|''"Пользователь чувствует, что вынужден следовать предполагаемым "правилам боя" но на самом деле он физически не может этого сделать. Их мозг перестраивается таким образом, чтобы оправдать любые странные проявления, возникающие из-за этого странного эффекта.»''
Запрещает субъекту атаковать людей, если он не атакован первым.
|style='color:#0000FF'|''"You feel honorbound!"''
|-
!Burdened
|''"Пользователь чувствует себя обязанным наносить себе различные травмы, лишающие трудоспособности и вызывающие ужас. Как ни странно, этот ген, похоже, связан с несколькими другими, возможно, готовыми вызвать новые генетические изменения в будущем."''
Дает ''Telepathy'' и ''Mute'', затем ''Telekinesis'' и ''Mind Reader'' по мере того, как субъект становится все более обремененным инвалидностью и дебаффами (травмы, отсутствие конечностей и органов, зависимости, мутации...).
|style='color:#0000FF'|''"You feel burdened!"''
|}

==== Админ спавн гены ====

{| class="wikitable sortable mw-collapsible mw-collapsed" border="1" cellspacing="0" cellpadding="2"
!style = "background:{{ColorPalette|Medical|Primary}};"|Name
!style = "background:{{ColorPalette|Medical|Primary}};"|Description
!style = "background:{{ColorPalette|Medical|Primary}};"|Indicators
!style = "background:{{ColorPalette|Medical|Primary}};"|Message
!style = "background:{{ColorPalette|Security|Primary}};"|Instability
|-
!X-Ray Vision
|''"Странный геном, который позволяет пользователю видеть пространства между стен."''
По сути, это дает субъекту способность видеть все, что находится за пределами его обычного зрения: стены, мебель, даже других людей! В сочетании с телекинезом это смертельно опасная комбинация. По сути замена [[Research_items#X-Ray_Implant|X-Ray импланта]].
|Глаза субъекта «жутко светятся».
|style='color:#0000ff'|''"The walls suddenly disappear."''
|35
|-
!Laser Eyes
|"Отражает концентрированный свет из глаз."
Позволяет стрелять лазерными лучами (20 урона).
|Глаза субъекта светятся
|style='color:#0000ff'|''"You feel pressure building up behind your eyes."''
|-
!Elvis
|Заставляет языковой центр и первичную моторную кору мозга субъекта говорить и действовать как король рок-н-ролла.
|Ужасающая мутация, названная в честь своего «пациента-ноль».
|style='color:#0000FF'|''"You feel pretty good, honeydoll."''
|-
!Unstable DNA
|Заставляет субъекта случайным образом мутировать. Очень опасно. Будьте осторожны с этим.
|Странная мутация, которая заставляет обладателя случайным образом мутировать.
|style='color:#ff0000'|''"You feel strange."''
|}

=== Руководство по поиску и использованию мутаций ===
Это руководство шаг за шагом покажет вам, как найти силы из таинственных блоков!

==== Первые шаги ====
В этом руководстве мы начнем с использования обезьяны, ведь они не просто так находятся в камеры.

* Начните с того, что возьмите '''обезьяну''' из загона.

* Засуньте её в '''DNA Scanner''' рядом с камерой, перетянув ее.

* Проверьте '''консоль''' рядом, вы увидите кучу вкладок. Найдите ''Genetic Sequencer''.

Все мутации рандомизируются каждый раунд.

==== Очеловечивание обезьяны ====
Всегда сначала очеловечивайте обезьянку, иначе ее способности не сработают или не будут пригодны для сохранения.
# Вы и ваш приятель-генетик автоматически обмениваетесь найденными мутациями, поэтому работайте вместе, чтобы открыть их все. Сохраненные мутации необходимо вручную передавать между компьютерами с помощью дисков с данными ДНК.
# Пройдитесь по мутациям и найдите ''Monkified''. Затем разбейте случайную пару, заменив букву на X с помощью CTRL+левый клик.
# Когда вы это сделаете, вы увидите, что имя наверху изменилось с «обезьяны» на случайно сгенерированное имя. Поздравляем, у вас есть свой собственный человек-обезьяна!
# Если по какой-то причине вы получили несколько плохих мутаций, а удалить их некому, возьмите в лаборатории бутылочку с таблетками [[Guide_to_chemistry#Mutadone|мутадона]]. Обычно у вас есть несколько таблеток по 5u, что является излишеством. Растворите таблетку, налив небольшое количество воды в любую емкость (один раз использовав бикер на раковине, затем опустите в него таблетку [[Guide_to_chemistry#Mutadone|мутадона]] и сделайте глоток. Это мгновенно избавит вас от всех мутаций.
# [[Guide_to_chemistry#Mutadone|Мутадон]] также уберет мутацию ''monkified'' у обезьяны, мгновенно превратив в человека. С помощью пипетки, настроенной на 1u, сцедите растворенный [[Guide_to_chemistry#Mutadone|мутадона]] в глаза обезьян для их массового очеловечивания без использования каких-либо механизмов. Однако это не поможет вам открыть мутацию monkified.

==== Проявление мутаций ====
Возвращаемся к делу! Сейчас мы попробуем заставить мутацию проявить себя:

# Найдите мутацию со сломанными парами.
# Начните заполнять X. Это довольно легко, поскольку большинство из них соединены с буквами A, T, C или G. Так что X-T будет A-T.
#* Левый клик увеличивает размер от A до G (A>T>C>G>A) - правый клик - наоборот.
# Часто встречаются пары X-X. Сначала убедитесь, что остаток фиксирован, а затем угадайте его. Есть 4 варианта. AT, TA, GC и CG.
# Если двойных X-пар больше двух, воспользуйтесь генетическим сканером (как описано выше), просканировав других обезьян, себя или случайных членов команды, или опцией JOKER при редактировании генов, которая найдет нужную букву за вас (очень долгая перезарядка - 20 минут на не улучшенных сканерах).
# Если заполнение всех пар не помогло, возможно, вы где-то ошиблись. Проверьте дважды. Также убедитесь, что в сканере человека, а не обезьяна. Если ничего не вышло, переходите к другой мутации или [[#Scramble DNA|scramble]] (перемешайте) их ДНК.

==== Scramble DNA ====
При нажатии на кнопку Scramble DNA ДНК субъекта подвергнется разрушительному генетическому воздействию и случайным образом изменит количество обнаруживаемых мутаций. Это также наносит большое количество генетических повреждений за один раз.

{{Anchor|Activators_and_Injectors}} 
==== [[File:DNA Injector.png|64px]] Активаторы и мутаторы (Activators and Injectors) ====
После проявления мутации в [[#Genetic_Sequencer|Genetic Sequencer]], нажмите ''store'' чтобы сохранить их во вкладку "Storage - Mutations" . Активаторы и мутаторы можно распечатать как из секвенсора, так и из вкладки Storage - Mutations.

*'''Активаторы:''' Активатор навсегда активирует специфическую мутацию у человека, у которого она уже находится в спящем состоянии, как показано в [[#Genetic_Sequence_Scanner|Genetic Sequence Scanner]] [[File:Gene_scanner.gif]]. Например, поскольку во всех людях дремлет мутация monkified, активатор monkified всегда будет работать на людях. Использование активатора не увеличит [[#Genetic_Instability|генетическую нестабильность]]. Использованные активаторы могут быть переработаны в консоли доступа к сканеру ДНК для производства [[#Chromosome_21|хромосом]].
*'''Мутаторы:''' Мутатор проявит мутацию в человеке, независимо от того, есть ли у него эта мутация в спящем состоянии или нет. Это вызовет [[#Genetic_Instability|нестабильность]] в его генах (вызывает несколько плохих эффектов, если она достигает 100%). Мутация и ее нестабильность могут быть устранены приемом [[Guide_to_chemistry#Mutadone|мутадона]].
 
Консоль DNA Scanner Access требует времени для перезарядки после производства активатора или мутаторов. Активаторы имеют гораздо более короткий период перезарядки.

==== [[File:DNA Injector.png|64px]] Продвинутые инжекторы (Advanced Injectors) ====
[[File:Time-Green_advanced_injectors_first_screenshot.png|thumb|200px|right|Это страничка "Adv. Injectors" . ]]
После обнаружения одной или нескольких мутаций у вас есть возможность создать продвинутые инжекторы. Продвинутые инжекторы позволят вам сохранить несколько мутаций в одном инжекторе. Количество мутаций в одном «сохранении» ограничено 50 [[#Genetic_Instability|нестабильностью]] или 10 мутациями. В отличие от активаторов или обычных мутаторов, их можно назвать как угодно. Чтобы создать расширенный инжектор, сделайте следующее:
#Перейдите в "Storage - Adv. Injectors". Нажмите "Create new injector" и выберите имя, чтобы создать новый слот, в котором будут сохранены мутации.
#Перейдите в [[#Genetic_Sequencer|Sequencer]] или "Storage - Mutations" и нажмите на сохраненную или изученную и активированную мутацию.
#Нажмите "Add to advanced injector". Выберите название слота, который вы сделали в пункте 1. Повторить со всеми остальными мутациями, которые вы хотите поместить в тот же инжектор.
#Вернитесь в "Adv. Injectors". Нажмите ''Print''. Вы напечатаете инъектор, который будет называться "Advanced (название) injector".

==== Генетическая нестабильность (Genetic Instability) ====
Когда у вас проявляются мутации - вам может показать сообщение что то типа: "It feels like your skin is moving." Это говорит о том, что ваша генетическая нестабильность возросла, и вам нужно быть осторожным, чтобы не добавить слишком много генов.Все люди могут выдержать до '''99 генетических нестабильностей''', прежде чем начнут пузыриться и таять. 100 нестабильности будет слишком много. То, что происходит, когда вы страдаете от генетического сбоя, случайно и непредсказуемо, и берется из одного из двух списков эффектов, от «почти безвредного» до «мертвого и невосстановимого». Отрицательные мутации, как правило, не дают нестабильности, а вот положительные - дают. Как правило, чем сильнее мутация, тем больше нестабильности она дает. Выбирайте с умом.
==== Хромосома 21 ====
Каждый раз, когда вы успешно используете АКТИВАТОР на другом человеке, активатор наполняется генетическими данными. Переработайте или используйте его на консоли ДНК, чтобы с вероятностью 60 % получить случайную хромосому. Хромосома хранится в "Storage - Chromosomes".Щелкнув по хромосоме, вы получите информацию о ней. Вы также можете извлечь ее в физическую форму. Физические хромосомы можно использовать, только вставив их в консоль ДНК. 

Каждая активная мутация в человеке имеет один хромосомный слот. Вы можете добавлять хромосомы только людям, находящимся внутри подключенного DNA scanner. Для этого откройте ''Sequencer'' tab. Затем щелкните активированную мутацию, или [[#Manifesting_Mutations|найдите]] ее, если она еще не была найдена. Вы увидите строку ''Select a chromosome'' возле которой будет список хромосом с которыми мутация будет совместима. Выберите хромосому в открывшемся меню, и теперь вы заполнили слот для хромосомы этой мутации. Чтобы удалить хромосому из мутации, нужно деактивировать и снова активировать мутацию, изменив любую букву, а затем верните обратно. 

После добавления хромосомы к мутации вы можете сохранить ее в Storage ''- mutations'' как обычно (нажав ''Save to console'' в ''Sequencer'' tab). Мутации мутаторов/активаторов, напечатанные из этой сохраненной записи, будут содержать эту хромосому. Сохраненная запись сохранит свою хромосому, если ее сохранить в Genetics data disk и перемещать между консолями DNA Scanner console.

Вот доступные на данный момент хромосомы, которые вы можете получить (вероятность того, что хромосома будет определенного типа, указана рядом с этим типом в скобках):
* '''Synchronizer''' (5/16): Дает разуму больше контроля над мутацией, снижая некоторые недостатки на 50%.
* '''Stabilizer''' (1/16): Самая редкая хромосома. Уменьшает [[#Genetic_Instability|нестабильность]] от мутаций на 20%.
* '''Power''' (5/16): Усиливает силу некоторых мутаций. Экспериментируйте с суперчихом или еще более смертоносными огненными шарами!
* '''Energetic''' (5/16): Уменьшает перезарядку на мутации

Хромосомы не должны добавляться к мутациям, которые не получат от них пользы. апример, вы не можете использовать энергичную хромосому для мутации обезьяны.

=== Что делать с вашими способностями ===

* Экспортируйте свои лучшие способности на диск в качестве резервной копии. Всегда есть риск, что [[AI|ИИ]] или кто-то другой удалит их по какой-либо причине.
* Сделайте инжекторы, чтобы подарить <s>[[Assistant|тайдерам]],</s> [[Chain_of_Command#Heads_of_Staff|главам]], [[Security|офицерам]], или [[Engineer|инженерам]]. Вы также можете продавать их за деньги!
* Из-за того, что существуют инжекторы, случайные люди могут просить силы у генетиков. Решайте, кому давать способности, а кому нет, потому что ничто так не раздражает станцию, как стадо ассистентов с Халком. Будьте готовы часто говорить «нет». Вам разрешено иметь способности, но если вы бегаете по станции в образе Халка, не устраивайте буйство с убийствами и разрушениями, так как это запрещено.
* Наслаждайтесь бытием на пике человеческой эволюции. Используйте ваши силы чтобы творить добро или превратить жизнь службы безопасности в ад, ломая стены в особо охраняемые зоны и будучи невосприимчивым к оглушению. Запомните, что халки для AI не люди, и когда служба безопасности не может кого-то оглушить, они берутся за летальное оружие.

=== Исцеляйте своих субъектов и себя ===
Во время экспериментов ваши субъекты могут получить травмы, будь то удар головой о генетическую капсулу или негативные мутации, самое очевидное это ''H.A.R.S.'' и ''Radioactive''. Если вам не повезет, вы можете пострадать. Для этого есть несколько решений:
* [[Roboticist|Роботехи]] могут построить вам [[Guide_to_robotics#Medibot|медботов]]. Белые исцеляют физические повреждения, но есть также зеленые и желтые, способные исцелять токсины/радиацию и ожоги соответственно.
* [[Chemist|Химики]] может предоставить вам специальные лекарства, в том числе [[Guide_to_chemistry#Potassium_Iodide|Potassium Iodide]] для лечения радиации, [[Guide_to_chemistry#Pentetic_Acid|Pentetic Acid]] для токсинов и радиации, а также несколько других для ожогов, брута и всего остального, что вам может понадобиться.

Остерегайтесь, что радиоактивные субъекты могут облучить вас и близлежащие предметы, поэтому быстро устраняйте мутацию, как только найдете ее.

=== Изменение CRISPR ===

Это позволяет целенаправленно менять базовые мутации. Базовые мутации не страдают от [[#Genetic_Instability|нестабильности]]

==== Получение заряда CRISPR ====
Для начала вы должны получить заряд CRISPR. Это образец вируса с генетическими способностями, которые вы можете использовать чтобы поменять базовые мутации.
* Заставьте Виро создать вирус, используя либо [[Infections#Symptoms_Table|Dormant DNA Activator]] или [[Infections#Symptoms_Table|Viral Evolutionary Acceleration]] (В идеале - доброкачественные)
* Придерживайтесь протокола сдерживания, проверяйте себя на наличие болезней, если появятся симптомы, надейтесь, что лекарство будет доступно, если все пойдет не так.
* Заразите содержащуюся обезьяну, используйте на ней Активатор (не Мутатор) - она собирает заряд, когда собирает хромосомы.
* Засуньте использованный активатор в консоль, чтобы добавить заряд в консоль

==== Использования зарядов CRISPR ====
Вам понадобятся верхние ряды последовательностей пар целевой мутации и мутации, на которую вы хотите заменить целевую. Вот базовый порядок действий:
* Решите мутацию, которую вы хотите использовать, или просто используйте мутатор на хуманизированной обезьяне
* Обратите внимание на верхний ряд
* Решите мутацию которую вы хотите заменить у субъекта
* Используйте заряд CRISPR на нем
* Скормите специальную строку CRISPR которая проинструктирует вирус заменить эту мутацию на желаемую

===== Создание строки CRISPR =====
Например, допустим, эпилепсия - это
* '''<code>A T T A C G C G A T T A C G C G</code>'''
* '''<code>T A A T G C G C T A A T G C G C</code>'''

А телекинез - это
* '''<code>A T A T C C G G A T T A C C G G</code>'''
* '''<code>T A T A G G C C T A A T G G C C</code>'''

Обратите внимание на первый ряд обоих
* эпилепсия - это '''<code>A T T A C G C G A T T A C G C G</code>'''
* телекинез - это '''<code>A T A T C C G G A T T A C C G G</code>'''

Затем переплетите эти ряды между собой, старый-новый-старый-новый, вот так:
* '''<code>_A T A T C C G G A T T A C C G G :NEW (Telekinesis)</code>'''
* '''<code>AATTTAATCCGCCGGGAATTTTAACCGCCGGG :CRISPR String</code>'''
* '''<code>A T T A C G C G A T T A C G C G_ :OLD (Epilepsy)</code>'''

Затем, когда вы используете CRISPR на решенной базовой мутации, которую вы намеревались заменить, воспользуйтесь этой строкой. Она заменит Эпилепсию на Телекинез
* '''<code> AATTTAATCCGCCGGGAATTTTAACCGCCGGG </code>'''

Если ваша строка неправильной длины, ничего не произойдет, но если строка ошибочна – вы можете получить мутацию Кислотная Плоть вместо нужной, но перемешанной и без подсказок – надейтесь, что у вас остались активаторы! Осторожно, не ошибитесь несколько раз, чтобы не переписать несколько мутаций на одну и ту же и не пришлось перетасовывать, чтобы вернуть их обратно.

Также запомните, заряд CRISPR есть обработанный вирус, который может иногда выйти из-под контроля и случайным образом заразить вас.

 Поздравляем. Если вы прочитали все, что написано в этом руководстве, то теперь вы должны стать полноценным генетиком.

==Инфузии ДНК ==
Обычных мутаций недостаточно? Чувствуете потребность изменить свой человеческий облик? Может быть, вам слишком нравятся эти странные японские мультфильмы? Новый ДНК-инфузор, расположенный в генетике, позволит вам стать настоящим ЗВЕРЕМ с помощью... науки! Достаточно поместить труп жизнеспособного (или не жизнеспособного) животного и живого субъекта, и машина уничтожит труп, заменив один из органов субъекта новым набором органов мутанта. Достаточное количество органов того же вида мутантов сделает вас настоящим мутантом соответствующего вида, возможно, изменив ваш вид или вызвав другие положительные или отрицательные эффекты!
{| class="wikitable"
|+
!Тип мутанта
!Животные с совпадающей ДНК
!Возможные органы мутантов
!Органы, необходимые для набора бонусов
!Бонус за набор
|-
|Неподходящие
|Все, что не указано в данном списке
|Глаза мухи, хоботок, сердце мухи, легкие мухи, печень мухи, желудок мухи, аппендикс мухи.
|4
|Превращает вас в полноценного мухочеловека, каким можно стать, прыгнув в нотколиброванный телепортер. Зачем, черт возьми, вам это нужно?
|-
|Карп
|Космиечкий карп
|Лёгкие карпа (позволяют дышать в космосе, но не на станции),
Челюсти карпа (более сильные укусы и могут выпадать зубы карпа, нельзя ничего надеть в слот маски),

Мозг карпа (по таймеру выдает вам негативное настроение, советуя «отправиться исследовать космос», то есть переместиться на другой Z-уровень),

Сердце карпа.
|4
|Позволяет свободно перемещаться в космосе, как карп!
|-
|Крыса
|Грызуны
|Крысиные глаза (чувствительны к свету, но обладают ночным зрением),
Крысиный желудок, крысиное сердце, крысиный язык.
|4
|Получите возможность проползать через вентиляцию на станции станции, если вам не мешает одежда.
|-
|Голиаф
|Голиаф
|Глаза голиафа (ночное зрение),
Легкие голиафа (позволяет дышать на Лаваланде, но
Не на станции),

Мозг голиафа (без перчаток, но одна из ваших рук становится молотом тендилом),

Сердце голиафа (делает вас имунным к бурям на Лаваленде
|4
|Делает вас имунным к лаве.
|-
|Кошка
|Кошка
|Кошачий хвост, кошачие ушки
|N/A
|Теперь ты полукошка, как в мультиках с девочками, которые тебе так нравятся.
|-
|Лиса
|Лиса
|Лисьи уши
|N/A
|У тебя лисьи уши, как у той девушки с плаката, который висит у тебя на стене.
|}

==[[File:scanner.gif|32px]][[File:Medcom.gif|32px]][[File:Clone.gif|32px]] Клонирование ==
Клонирование было удалено в декабре 2020. Это часть статьи осталась лишь в качестве истории.
<div class="toccolours mw-collapsible mw-collapsed">
Expand for the old guide to cloning.
<div class="mw-collapsible-content">
For a cloning process we need a dead body and cloning equipment, which can be found in your Cloning Room.

# First of all, you have to know that for all things cloning, the [[Chief Medical Officer]] has a final say. He is your boss on this side of Genetics. If he tells you to clone someone and not some other guy, you do it. The only person with higher say than him on these matters is the Captain.
# On to the specifics! How to clone: Just '''grab or pull''' a body and stuff it '''into the [[DNA Scanner]] and close the door'''. If you want to remove someone from a Scanner, click on it to open the door. Unless the Scanner is locked, the person/monkey inside is going to pop right out. [[File:Cloning_console_scan_successful.png|thumb|200px|right|This is the cloning console menu.]]
# When the Scanner is occupied, '''interact with the Cloning Console'''. You will see a few options. The most important one is "scan". Click it. If they can be cloned, scanning will succeed regardless of whether they're in their body or not. There are several possible errors that can happen when you try to scan. See the [[#Cloning_Error|section about cloning errors]] for details.
# If scanning is successful, you will get a '''''Successful Scan'' -message'''. That means you now have that person's cloning data saved. You can use this record to steal their genetic data at any time, but cloning is more limited - if their last death happened after they got scanned, any attempts to clone using the scanned record will fail. [[File:Cloning_console_view_records.png|thumb|200px|right|This is what you see after clicking "View Records".]]
# After you actually have DNA data from a person, '''click Check Records''', and then '''click View Record''' of the person who you want to clone. You will see a list of their [[#Unique_Identifiers|UI]](Unique Identifiers) and their [[#Structural_Enzymes|SEs]] (Structural Enzymes). These can be copied and pasted with a cloning data disk (see one of the images to the right). '''Click Clone'''. You will notice that the Cloning Pod is now fully active, with a shadow inside. That is the new body. You can now '''take the old corpse out of the DNA Scanner''', '''strip it completely''' so the cloned person can have their stuff back, and '''place the old corpse inside a body bag in the morgue'''. You don't have to worry about the old corpse anymore. [[File:Cloning_console_view_record_with_disk.png|thumb|200px|right|This is what can you see after clicking a specific "View Record" under "View Records". If you have an ID with cloning access you can delete a record. Otherwise it will say "access denied" when trying to delete it. If you have inserted a "cloning data disk" you have additional options to save or load [[#Unique_Enzymes|UE]], [[#Unique_Identifiers|UI]] and [[#Structural_Enzymes|SE]] (dormant mutations) to and from that disk.]]
# The cloning process takes about 2 or 3 minutes depending on upgrades. For whoever is getting cloned, it may feel like a very long time. While the person is getting their new body formed, take their '''belongings and stuff them all into a locker''', so they're not scattered all over or stolen. Cloning the captain and leaving their ID or other secure items on the floor is bad.
#* '''Aborted cloning:''' Use this as [[traitor]] to screw with that assistant who talked smack to you earlier. During the cloning process, it is possible to eject the incomplete clone by unlocking the Cloning Pod with your ID and ejecting the unfinished clone (needs to be >40% done) or by getting an Engineer to unlock the Genetics APC so you can shut off the power temporarily, which also causes the clone to (instantly, no matter how done) eject. This will usually clone people without limbs or vital organs, making them die quickly.
# The cloned people often have cellular damage. If so, take them to cryo to fix it.
# After the pod is empty, feel free to '''clone your next patient''', and to let the old one out, since they most likely don't have clearance to open the door.
# If R&D has been doing their job, they might upgrade the cloner to a level where it can '''autoprocess'''. If this is the case, you only have to press the Autoprocess button on top of the window, and the cloner will scan and clone automatically. This is useful to process a large pile of bodies quickly. Scan them one at a time, and autoprocess will do the rest.

=== [[File:Husk.png|64px|OH GOD OH FUCK]] Hark! A Husk! ===
So you've come across a [[husk]] (a grey corpse) on your floor, which means you can't clone that poor sod without upgrades. Before you go throwing that body in the morgue, they can still be helped!

# First off, make sure it's a husk. Throw the body into a DNA Scanner, if it says ''Subject no longer contains the fundamental materials required to create a living clone'', then you have yourself a husk (if your DNA Scanner had been [[Guide_to_advanced_construction#DNA_Scanner|updated]] to the max by the Scientists, you could clone the husk right now. So if you know they've been doing their R&D, ask them).
# Take the body down to [[Surgery]].
# Pester the CMO or a Medical Doctor to extract the brain, or do it yourself.
# Put the brain in the DNA scanner like you would a body.

Optionally a husk can be unhusked with [[Guide_to_chemistry#Rezadone|rezadone]]. If all goes well then your cadaver will be reborn. 

====Changeling Victims====
If examining the husk shows "He/she is limp and unresponsive; there are no signs of life... " it means the body has a soul online. If the corpse still can't be scanned in fully upgraded cloning, it's possible it was someone who got absorbed by a [[Changeling|changeling]]. There appears to be no easy way to revive absorbed victims. Not even through brain transplants.

=== Helping the Headless ===
Sometimes you'll find a corpse whose head is separated from their body. Thanks to the marvels of modern science, this is not a problem!

#If you have a head or a brain, just chuck it into the cloner as normal. This may require the DNA scanner to be upgraded though. To clone a head or brain you must throw it into the DNA Scanner by activating throw with '''R''' and then clicking it, or by walking into the DNA scanner and dropping the head/brain. Then click the cloner to close it.
#If you don't have the head, but you have the body, not all hope is lost: take a blood sample and give it to the botanist to make a replica pod, and the deceased guy will be reborn as a podperson!
#If you have neither, he's dead for good.

===Cloning Plasmamen===

If the patient is a [[plasmaman]], cloning them will be complicated by the fact that the naked patient will burn in the station's atmosphere. This can be dealt with by using showers to keep the patient from catching fire, then dressing them in a plasma envirosuit.
# Put plasmaman into cloning scanner
# Scan them, start the cloning process
# Drag their dead body to cloning pod
# Undress them and leave their clothes in a pile
# Turn on shower near cloning pod
# Once they pop out of cloner, put them under shower and wait for them to dress up

If the patient is a naked or beheaded plasmaman, follow these additional steps:
# Once they pop out of cloner, put them under shower and feed them a few [[Guide_to_chemistry#Salbutamol|Salbutamol]] pills (if available), or if desperate, keep a syringe of [[Guide_to_chemistry#Perfluorodecalin|Perfluorodecalin]] ready in case you need it. Plasmamen suffocate if they don't have plasma to breathe!
# Yell at [[Supply_crates|cargo]] to order plasmaman supplies. In the meantime, bug Engineering/Atmos for a filled plasma tank.

===Empty Cloning===
Cloners have the option to "Empty Clone" a record, creating a mindless replica of a person. To complement this function, cloners can do Body-Only scans, which can only be used to create empty clones but not real clones, and bypass the sentience restrictions that ordinary scans have. These body-only entries can be deleted without requiring access.

=== Cloning Errors ===

{| class="wikitable"
|-
! Error message
! Cause
! Solution
|-
| Unable to locate valid genetic data.
| Whatever you put inside the scanner doesn't have valid (humanoid) DNA.
| Stop putting bees in the scanner.
|-
| Subject's brain is not responding to scanning stimuli.
| The person inside has suicided or signed an infernal contract. Cloning is impossible.
| Let the [[Cook]] take care of them or put the body in the morgue.
|-
| Subject no longer contains the fundamental materials required to create a living clone.
| You're trying to scan a body that's been husked or smashed by megafauna, but your scanner doesn't have a (tri-)phasic scanning module.
| Remove the brain and scan it. Yell at RnD to upgrade your scanner.
|-
| Mental interface failure.
| The corpse has no ghost associated with it.
| Try again in a few seconds - ghosts get notified when someone attempts to scan their body. No success? Let the [[Cook]] handle it.
|-
| Subject already in database.
| That person has already been scanned.
| Start the cloning process. Want to update the current clone scan? The CMO can delete scan files.
|-
| Initialisation failure.
| The patient is still alive.
| Try again when the patient is dead.
|-
| Unable to initiate cloning cycle.
| Cloning has been disabled in the server config.
| Yell at admins and hand the corpse over to the [[Chef]].
|-
| Corpse has no head.
| [[Changeling|Some asshole]] decapitated your guy - clone scanning is impossible without a brain.
| Draw a blood sample and ask [[Botany]] to clone them with the Replica Pod plant. Can't draw blood either? Your patient is out of luck.
|}

Keep in mind that patching up a corpse with Synthflesh and then reviving it with Strange Reagent bypasses a lot of these issues.

</div>
</div>

== Генетический гений, предатель - генетик ==
Простите за неудачное название главы. Я очень долго хотел его использовать.

Итак, вы научились успешно выполнять свою работу и приносить пользу станции. Вы научились манипулировать генами. Теперь вы хотите узнать, что, черт возьми, делать, когда синдикат выписывает вам цели! Что ж, не волнуйтесь! Я дам вам несколько советов. Но это в лучшем случае советы - предательские цели дико отличаются друг от друга и слишком сильно меняют ваши действия, чтобы я мог написать по ним настоящее руководство.

=== [[Revolutionary|Революционер]] ===
Если вам удалось убить главу , скопируйте его личность с помощью сканера ДНК и примените ее к себе. Выдавать себя за главу во время революции полезно, так как они обычно освобождены от имплантации.

=== [[Traitor|Предатель]] ===
Зависит от вашей цели. Если она сложная, например, похищение ИИ... что ж, вам крышка. Продолжайте работать над способностями! Как только у вас будет Халк + ТК, действуйте по своему усмотрению. Никаких советов.

=== [[Changeling|Генокрад]] ===
Чтобы быстро собрать хранящиеся геномы, можно провести поглотить очеловеченных обезьян. Точно так же, как только люди начнут приходить за мутациями, у вас будет много ДНК для сбора ваших способностей.

=== Ретурн ту монке ===
Если вам нужны бонусы к бою или скрытности, вы можете использовать ''Monkified'' чтобы стать обезьяной, as well as several useful mutations также несколько полезных мутаций (например, телекинез, шоковое прикосновение, хамелеон, гигантизм и карликовость). Обезьяны обладают способностью красть предметы из рук людей, ползать по вентам и рядом других преимуществ. Превращение не требует больших затрат и доступно в самом начале раунда (в отличие от превращения в слаймомена у [[Scientist|ксенобиолога]]).

{{anchor | Guide_to_gorilla}}
Кроме того, существуют [[Critters#Gorilla|гориллы]]. У вас появился почти эксклюзивный доступ к гориллам. Вы можете превращать обезьян в горилл, включая себя, других членов экипажа или антагонистов.

Учитывая их статус симплмоба, гориллы невосприимчивы к ранам и большинству химических веществ - по сути, это слабости Халка. Кроме того, они невосприимчивы к оглушению и толчкам (как Халки), вирусам и мутациям. В отличие от Халков, они не могут разрушать укрепленные стены.
* Обратите внимание, что гориллы, таким образом, также невосприимчивы к их преимуществам и к операциям. Исцеление будет сложнее, чем у халков, и кто-то может использовать лазарус на их трупы, чтобы помочь в борьбе с другими гориллами.

ИИ гориллы крайне враждебны, сохраняют агр до тех пор, пока их цель не умрет, и имеют склонность отрывать конечности у трупов людей, или находящихся без сознания (в т.ч. при хард крите).

Чтобы превратить обезьяну в гориллу, у вас есть два варианта:
* Генетическая бомбардировка: при превышении 2500 единиц генетического урона у обезьян появляется 25% шанс в секунду трансформироваться.
* Mind-Magnification Helmets (Шлемы увеличения разума): при снятии шлемов ММ у разумной обезьяны есть небольшой шанс (2,5%) превратиться в такую же разумную гориллу.
Кроме того, Аплинк [[Traitor|предателя]] у генетика имеет [[Syndicate_Items#Box_of_Gorilla_Cubes|Gorilla Cubes]] и [[Syndicate_Items#Magillitis_Serum_Autoinjector|an autoinjector]] который может превратить его в гориллу.

[[Category:Guides]]